Incidental Mutation 'R5056:Mbd6'
ID450631
Institutional Source Beutler Lab
Gene Symbol Mbd6
Ensembl Gene ENSMUSG00000025409
Gene Namemethyl-CpG binding domain protein 6
SynonymsD10Wsu93e
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5056 (G1)
Quality Score59
Status Validated
Chromosome10
Chromosomal Location127281956-127289018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127286441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 173 (V173I)
Ref Sequence ENSEMBL: ENSMUSP00000112805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078] [ENSMUST00000139091] [ENSMUST00000156208] [ENSMUST00000172567] [ENSMUST00000230446]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026476
AA Change: V173I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409
AA Change: V173I

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119078
AA Change: V173I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409
AA Change: V173I

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134686
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156208
SMART Domains Protein: ENSMUSP00000114590
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
SCOP:d1qk9a_ 22 88 6e-5 SMART
Blast:MBD 26 79 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172567
SMART Domains Protein: ENSMUSP00000134527
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 66 N/A INTRINSIC
low complexity region 81 115 N/A INTRINSIC
low complexity region 119 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect probably benign
Transcript: ENSMUST00000230446
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Mbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Mbd6 APN 10 127284119 unclassified probably benign
IGL01685:Mbd6 APN 10 127284732 unclassified probably benign
IGL02741:Mbd6 APN 10 127287394 critical splice donor site probably null
IGL03090:Mbd6 APN 10 127287144 missense probably damaging 1.00
IGL03395:Mbd6 APN 10 127283417 missense probably damaging 1.00
R0041:Mbd6 UTSW 10 127286872 missense probably damaging 1.00
R0480:Mbd6 UTSW 10 127285873 unclassified probably benign
R0507:Mbd6 UTSW 10 127283520 unclassified probably benign
R1686:Mbd6 UTSW 10 127287417 missense probably damaging 0.99
R3418:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3419:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3724:Mbd6 UTSW 10 127283891 unclassified probably benign
R3731:Mbd6 UTSW 10 127285768 unclassified probably benign
R3742:Mbd6 UTSW 10 127284943 unclassified probably benign
R3800:Mbd6 UTSW 10 127285167 unclassified probably benign
R5023:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5024:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5053:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5568:Mbd6 UTSW 10 127283428 missense possibly damaging 0.82
R5656:Mbd6 UTSW 10 127285286 unclassified probably benign
R7607:Mbd6 UTSW 10 127285230 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATCGCTACAGTGGAAGAG -3'
(R):5'- ACTGGAGAAGACAGCATTCG -3'

Sequencing Primer
(F):5'- CACCAGGTTGGATCGGAG -3'
(R):5'- CATTCGAGGCAGGGATGGACC -3'
Posted On2016-12-27