Incidental Mutation 'R5037:Sycp2l'
ID478077
Institutional Source Beutler Lab
Gene Symbol Sycp2l
Ensembl Gene ENSMUSG00000038651
Gene Namesynaptonemal complex protein 2-like
SynonymsEG621792, LOC218175
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location41114307-41174351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41129861 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 191 (M191K)
Ref Sequence ENSEMBL: ENSMUSP00000115127 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000124093
AA Change: M191K

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit early reproductive senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Sycp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Sycp2l UTSW 13 41146672 missense probably null 0.00
R0016:Sycp2l UTSW 13 41157500 intron probably benign
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0099:Sycp2l UTSW 13 41129525 splice site probably benign
R0471:Sycp2l UTSW 13 41150530 splice site probably null
R0582:Sycp2l UTSW 13 41137955 splice site probably benign
R0605:Sycp2l UTSW 13 41143466 missense probably benign 0.22
R1311:Sycp2l UTSW 13 41135185 nonsense probably null
R1999:Sycp2l UTSW 13 41118304 missense probably benign 0.11
R3115:Sycp2l UTSW 13 41148798 missense probably benign 0.41
R3977:Sycp2l UTSW 13 41141964 missense probably damaging 0.99
R3979:Sycp2l UTSW 13 41141964 missense probably damaging 0.99
R4643:Sycp2l UTSW 13 41143465 missense probably benign 0.01
R5027:Sycp2l UTSW 13 41129771 critical splice acceptor site probably null
R5780:Sycp2l UTSW 13 41129500 missense possibly damaging 0.61
R6216:Sycp2l UTSW 13 41141724 missense probably damaging 1.00
R7035:Sycp2l UTSW 13 41157497 missense unknown
R7179:Sycp2l UTSW 13 41129782 missense probably damaging 1.00
R7267:Sycp2l UTSW 13 41146594 missense possibly damaging 0.69
R7470:Sycp2l UTSW 13 41163104 missense probably benign 0.01
R7593:Sycp2l UTSW 13 41172716 missense probably damaging 1.00
R8030:Sycp2l UTSW 13 41172670 missense not run
R8218:Sycp2l UTSW 13 41118068 missense probably damaging 1.00
R8303:Sycp2l UTSW 13 41129799 missense probably damaging 1.00
Z1177:Sycp2l UTSW 13 41114364 unclassified probably benign
Z1177:Sycp2l UTSW 13 41146582 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAGATTCCGTGAAGCCCTCC -3'
(R):5'- AAAGCCAGGCCAAGTCTGTG -3'

Sequencing Primer
(F):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
(R):5'- AGGCCAAGTCTGTGCTTCAGTC -3'
Posted On2017-05-23