Incidental Mutation 'Z31818:Fndc5'
ID478395
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Namefibronectin type III domain containing 5
Synonyms1500001L03Rik, PeP, Pxp
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129136999-129144593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129139349 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 70 (D70N)
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
Predicted Effect probably damaging
Transcript: ENSMUST00000102600
AA Change: D70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: D70N

DomainStartEndE-ValueType
FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124746
Meta Mutation Damage Score 0.1699 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R1202:Fndc5 UTSW 4 129139445 missense probably damaging 0.97
R3962:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R4408:Fndc5 UTSW 4 129142529 splice site probably null
R5379:Fndc5 UTSW 4 129142094 missense probably damaging 1.00
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
R8254:Fndc5 UTSW 4 129138721 missense possibly damaging 0.86
RF014:Fndc5 UTSW 4 129142167 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGGACAAAGGCTCAGGAG -3'
(R):5'- GAGGCCATCTTTTCAGCCTC -3'

Sequencing Primer
(F):5'- CAAGGGTCTGACCTCAAATGCTTG -3'
(R):5'- CTTTTCAGCCTCGCGTGGG -3'
Posted On2017-06-26