Mutagenetix > Incidental Mutation

Incidental Mutation 'Z31818:Fndc5'

478395

Institutional Source

Beutler Lab

Gene Symbol

Fndc5

Ensembl Gene

ENSMUSG00000001334

Gene Name

fibronectin type III domain containing 5

Synonyms

Pxp, 1500001L03Rik, PeP

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

Z31818 (F1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

129030792-129038386 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129033142 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 70 (D70N)

Ref Sequence

ENSEMBL: ENSMUSP00000099660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102600]

AlphaFold

Q8K4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000102600
AA Change: D70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: D70N

Domain	Start	End	E-Value	Type
FN3	31	111	7.34e-9	SMART
Pfam:DUF4808	146	204	4.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124746

Meta Mutation Damage Score

0.1699

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.9%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dmrtc2	C	A	7: 24,576,583 (GRCm39)	P336T	probably benign	Het
Flt3	C	T	5: 147,303,728 (GRCm39)		probably null	Het
Gan	T	A	8: 117,922,536 (GRCm39)	I423N	probably damaging	Het
Itpr3	T	G	17: 27,314,452 (GRCm39)	L634R	probably damaging	Het
Ndufb5	T	A	3: 32,800,610 (GRCm39)	M74K	probably benign	Het
Or9m1b	A	T	2: 87,836,234 (GRCm39)	L287*	probably null	Het
Osbpl6	A	G	2: 76,385,426 (GRCm39)	R287G	probably damaging	Het
Pkd1l3	A	C	8: 110,395,924 (GRCm39)	N2098T	probably damaging	Het
Proser3	G	A	7: 30,245,790 (GRCm39)	P97L	possibly damaging	Het
Rag2	G	A	2: 101,461,150 (GRCm39)	A487T	probably damaging	Het
Sorl1	A	T	9: 41,952,892 (GRCm39)	C716*	probably null	Het
Ugt1a6b	T	C	1: 88,034,877 (GRCm39)	Y72H	probably benign	Het
Vmn2r74	T	C	7: 85,604,729 (GRCm39)		probably null	Het
Vps13a	C	T	19: 16,758,118 (GRCm39)	V6M	possibly damaging	Het

Other mutations in Fndc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02656:Fndc5	APN	4	129,033,239 (GRCm39)	missense	probably damaging	1.00
IGL03336:Fndc5	APN	4	129,033,711 (GRCm39)	missense	probably benign	0.00
N/A - 287:Fndc5	UTSW	4	129,033,142 (GRCm39)	missense	probably damaging	1.00
R0645:Fndc5	UTSW	4	129,033,630 (GRCm39)	splice site	probably benign
R1202:Fndc5	UTSW	4	129,033,238 (GRCm39)	missense	probably damaging	0.97
R3962:Fndc5	UTSW	4	129,033,688 (GRCm39)	missense	probably benign	0.23
R4408:Fndc5	UTSW	4	129,036,322 (GRCm39)	splice site	probably null
R5379:Fndc5	UTSW	4	129,035,887 (GRCm39)	missense	probably damaging	1.00
R5539:Fndc5	UTSW	4	129,032,514 (GRCm39)	missense	probably damaging	1.00
R6242:Fndc5	UTSW	4	129,033,688 (GRCm39)	missense	probably benign	0.23
R6951:Fndc5	UTSW	4	129,032,573 (GRCm39)	missense	possibly damaging	0.77
R7027:Fndc5	UTSW	4	129,033,316 (GRCm39)	missense	probably benign	0.00
R7112:Fndc5	UTSW	4	129,035,915 (GRCm39)	missense	probably benign	0.09
R8254:Fndc5	UTSW	4	129,032,514 (GRCm39)	missense	possibly damaging	0.86
R8947:Fndc5	UTSW	4	129,030,929 (GRCm39)	missense	probably benign	0.04
RF014:Fndc5	UTSW	4	129,035,960 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTGGACAAAGGCTCAGGAG -3'
(R):5'- GAGGCCATCTTTTCAGCCTC -3'

Sequencing Primer
(F):5'- CAAGGGTCTGACCTCAAATGCTTG -3'
(R):5'- CTTTTCAGCCTCGCGTGGG -3'

Posted On

2017-06-26