Incidental Mutation 'R0510:Rps6ka4'
ID47859
Institutional Source Beutler Lab
Gene Symbol Rps6ka4
Ensembl Gene ENSMUSG00000024952
Gene Nameribosomal protein S6 kinase, polypeptide 4
Synonyms1110069D02Rik, MSK2, 90kDa
MMRRC Submission 038704-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R0510 (G1)
Quality Score96
Status Validated
Chromosome19
Chromosomal Location6829085-6840601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6840498 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 17 (T17N)
Ref Sequence ENSEMBL: ENSMUSP00000131581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025903] [ENSMUST00000113440] [ENSMUST00000170516]
Predicted Effect probably benign
Transcript: ENSMUST00000025903
AA Change: T17N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025903
Gene: ENSMUSG00000024952
AA Change: T17N

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113440
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170516
AA Change: T17N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131581
Gene: ENSMUSG00000024952
AA Change: T17N

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and ATF1. The encoded protein can also phosphorylate histone H3 to regulate certain inflammatory genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: No phenotypic information associated with mutations in this gene have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Rps6ka4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Rps6ka4 APN 19 6831128 missense probably damaging 1.00
IGL01548:Rps6ka4 APN 19 6832323 missense probably benign 0.02
IGL02536:Rps6ka4 APN 19 6832071 missense probably damaging 1.00
IGL02902:Rps6ka4 APN 19 6832255 critical splice donor site probably null
IGL03299:Rps6ka4 APN 19 6832247 splice site probably benign
R1104:Rps6ka4 UTSW 19 6830996 missense probably damaging 1.00
R1620:Rps6ka4 UTSW 19 6838149 missense probably damaging 1.00
R1647:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1648:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1939:Rps6ka4 UTSW 19 6839466 missense probably damaging 1.00
R2370:Rps6ka4 UTSW 19 6830100 missense possibly damaging 0.93
R2412:Rps6ka4 UTSW 19 6829941 makesense probably null
R2571:Rps6ka4 UTSW 19 6838103 missense probably damaging 1.00
R2698:Rps6ka4 UTSW 19 6837352 missense probably benign 0.08
R3427:Rps6ka4 UTSW 19 6837755 critical splice donor site probably null
R3721:Rps6ka4 UTSW 19 6839277 missense possibly damaging 0.73
R3844:Rps6ka4 UTSW 19 6837803 nonsense probably null
R4092:Rps6ka4 UTSW 19 6832255 critical splice donor site probably null
R4169:Rps6ka4 UTSW 19 6831820 missense possibly damaging 0.92
R4677:Rps6ka4 UTSW 19 6839486 missense probably damaging 1.00
R4897:Rps6ka4 UTSW 19 6838099 missense probably benign 0.02
R4975:Rps6ka4 UTSW 19 6840310 unclassified probably null
R5631:Rps6ka4 UTSW 19 6830977 splice site probably benign
R6462:Rps6ka4 UTSW 19 6837589 missense possibly damaging 0.90
R6643:Rps6ka4 UTSW 19 6832363 missense probably damaging 1.00
R6939:Rps6ka4 UTSW 19 6838069 missense probably damaging 1.00
R7030:Rps6ka4 UTSW 19 6839624 missense probably damaging 1.00
R7902:Rps6ka4 UTSW 19 6831311 missense possibly damaging 0.81
R7985:Rps6ka4 UTSW 19 6831311 missense possibly damaging 0.81
R8021:Rps6ka4 UTSW 19 6830409 missense probably benign 0.01
U24488:Rps6ka4 UTSW 19 6832356 missense probably damaging 1.00
X0019:Rps6ka4 UTSW 19 6838140 missense probably damaging 0.97
X0027:Rps6ka4 UTSW 19 6837772 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTGAAAGCGGTTTCTCACCTCCC -3'
(R):5'- ATATCCTGCTGGACAGACACCTGG -3'

Sequencing Primer
(F):5'- GTTTCTCACCTCCCGTGCC -3'
(R):5'- TGGCTAGGAGGCTTACTCCAG -3'
Posted On2013-06-12