Incidental Mutation 'R0510:Proc'
ID47857
Institutional Source Beutler Lab
Gene Symbol Proc
Ensembl Gene ENSMUSG00000024386
Gene Nameprotein C
SynonymsPC, inactivator of coagulation factors Va, VIII
MMRRC Submission 038704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0510 (G1)
Quality Score168
Status Validated
Chromosome18
Chromosomal Location32123129-32139570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32125118 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 258 (T258I)
Ref Sequence ENSEMBL: ENSMUSP00000132226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171765]
Predicted Effect probably benign
Transcript: ENSMUST00000171765
AA Change: T258I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132226
Gene: ENSMUSG00000024386
AA Change: T258I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GLA 24 86 6.66e-30 SMART
EGF_CA 87 131 1.25e-6 SMART
EGF 138 175 3.62e-3 SMART
low complexity region 201 210 N/A INTRINSIC
Tryp_SPc 211 444 2.6e-82 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: This gene encodes the vitamin K-dependent protein C, which plays a vital role in the anticoagulation pathway. The encoded protein undergoes proteolytic processing including activation by thrombin-thrombomodulin complex to form the anticoagulant serine protease that degrades activated coagulation factors. A complete lack of the encoded protein in mice results in severe perinatal consumptive coagulopathy in the brain and liver, resulting in death within 24 hours after birth. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Inactivation of the locus results in death within 24 hours of birth due to consumptive coagulopathy. Thromboses and bleeding are observed in the brains and livers of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Proc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Proc APN 18 32123513 missense probably benign 0.05
IGL01071:Proc APN 18 32123717 missense probably damaging 1.00
IGL01287:Proc APN 18 32123820 splice site probably benign
IGL01298:Proc APN 18 32123552 missense probably benign 0.01
IGL01898:Proc APN 18 32133145 critical splice donor site probably null
IGL01977:Proc APN 18 32127419 missense probably benign 0.02
IGL02040:Proc APN 18 32134860 missense probably benign 0.07
IGL02724:Proc APN 18 32134872 missense probably damaging 1.00
IGL02852:Proc APN 18 32125155 missense probably damaging 1.00
IGL02901:Proc APN 18 32123625 missense possibly damaging 0.89
IGL03401:Proc APN 18 32123273 missense possibly damaging 0.96
R0110:Proc UTSW 18 32125118 missense probably benign 0.26
R0131:Proc UTSW 18 32135898 missense probably benign 0.01
R0988:Proc UTSW 18 32133483 missense probably benign
R1455:Proc UTSW 18 32123398 missense probably damaging 1.00
R1463:Proc UTSW 18 32133438 missense possibly damaging 0.69
R1546:Proc UTSW 18 32127410 missense probably damaging 1.00
R1711:Proc UTSW 18 32127406 missense probably benign 0.05
R3414:Proc UTSW 18 32123685 missense probably benign 0.00
R3911:Proc UTSW 18 32123705 missense probably damaging 1.00
R4276:Proc UTSW 18 32135914 missense probably benign 0.00
R4598:Proc UTSW 18 32123459 missense probably damaging 1.00
R4623:Proc UTSW 18 32127473 missense probably benign 0.32
R4758:Proc UTSW 18 32123810 missense probably damaging 0.97
R4941:Proc UTSW 18 32125113 missense possibly damaging 0.60
R5917:Proc UTSW 18 32127460 missense probably benign 0.07
R6349:Proc UTSW 18 32133433 missense probably benign 0.00
R6636:Proc UTSW 18 32123760 missense probably benign 0.00
R6735:Proc UTSW 18 32123648 missense probably benign 0.01
R7110:Proc UTSW 18 32133388 missense probably benign 0.30
R7310:Proc UTSW 18 32135899 missense probably benign 0.03
R7409:Proc UTSW 18 32127460 missense probably benign 0.03
R7597:Proc UTSW 18 32123636 missense probably damaging 1.00
R7598:Proc UTSW 18 32135876 missense probably benign 0.00
R7604:Proc UTSW 18 32134778 intron probably null
R7738:Proc UTSW 18 32127479 nonsense probably null
X0021:Proc UTSW 18 32123507 missense probably damaging 0.96
Z1176:Proc UTSW 18 32134979 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGAGGAGACCCCTGCTCAATAAC -3'
(R):5'- TGTGTGCCACTGGGATCAAGAAC -3'

Sequencing Primer
(F):5'- CCCTGCTCAATAACAGATATGTGG -3'
(R):5'- CACTGGGATCAAGAACCCAGG -3'
Posted On2013-06-12