Mutagenetix > Incidental Mutation

Incidental Mutation 'R0510:Hectd4'

47793

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

038704-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R0510 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121281896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 635 (Y635N)

Ref Sequence

ENSEMBL: ENSMUSP00000048345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: Y635N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: Y635N

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128514

Predicted Effect

probably benign
Transcript: ENSMUST00000201669

Meta Mutation Damage Score

0.0812

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (102/103)

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933408B17Rik	A	T	18: 34,596,151	D42E	probably damaging	Het
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Cdkal1	C	A	13: 29,691,596		probably null	Het
Celsr3	G	A	9: 108,827,005	C229Y	possibly damaging	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Col11a1	A	T	3: 114,105,456		probably benign	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf1	A	T	15: 76,603,657		probably benign	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Creld2	A	T	15: 88,819,956	N50I	probably damaging	Het
Cyb5r1	T	C	1: 134,409,692		probably benign	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dgat1	T	C	15: 76,511,567	Y72C	possibly damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Etfbkmt	C	T	6: 149,150,584	R96W	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Fat3	C	A	9: 15,999,685	E1674*	probably null	Het
Fbn1	A	G	2: 125,342,925		probably benign	Het
Gm5134	C	A	10: 75,974,245	T120N	probably benign	Het
Gm5415	T	A	1: 32,545,875	N318I	possibly damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Gmip	C	T	8: 69,815,609		probably benign	Het
Gpbp1	G	T	13: 111,440,745	Q204K	possibly damaging	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gsdme	C	A	6: 50,246,127		probably benign	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Itpr2	T	C	6: 146,417,979	T188A	possibly damaging	Het
Kcnh1	T	A	1: 192,418,941		probably benign	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Mtss1	A	T	15: 58,956,538	D175E	probably benign	Het
Myef2	A	T	2: 125,109,034		probably benign	Het
Neb	A	T	2: 52,290,743		probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr305	T	C	7: 86,363,827	N170S	probably benign	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Parp3	A	G	9: 106,471,796	F466L	possibly damaging	Het
Pcdh15	A	T	10: 74,290,976	N296Y	probably damaging	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Pim1	T	C	17: 29,493,909		probably benign	Het
Pou6f2	A	G	13: 18,139,723		probably benign	Het
Prelid3b	A	G	2: 174,465,950		probably benign	Het
Proc	G	A	18: 32,125,118	T258I	probably benign	Het
Rab3gap2	T	C	1: 185,260,508		probably benign	Het
Rb1cc1	A	C	1: 6,249,171	K938T	probably benign	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rin2	A	G	2: 145,861,033	K550E	probably benign	Het
Rps6ka4	G	T	19: 6,840,498	T17N	probably benign	Het
Rtn4	T	A	11: 29,733,849		probably benign	Het
Ruvbl2	C	T	7: 45,431,306		probably benign	Het
Scaper	A	G	9: 55,758,062		probably benign	Het
Sdc2	T	C	15: 33,017,089		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Smpdl3b	A	G	4: 132,745,138	V108A	probably damaging	Het
Sptbn4	C	T	7: 27,361,566		probably null	Het
Srrm1	G	A	4: 135,338,543		probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ubr4	T	G	4: 139,430,223	S2364A	probably benign	Het
Ush2a	T	A	1: 188,734,663		probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Vwa2	A	G	19: 56,898,068		probably benign	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zbtb10	T	A	3: 9,264,668	V362E	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp296	A	T	7: 19,577,906	M113L	probably benign	Het
Zfp729b	A	T	13: 67,591,134	V1004E	probably benign	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9712:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAAGCCACCTGAGTGCATCC -3'
(R):5'- GCCTTCCTGTCACAGACAACAGAG -3'

Sequencing Primer
(F):5'- TTCTCACACAGGAGCTGAGC -3'
(R):5'- AACAGAGGGTTTCTCCTCAAATTCC -3'

Posted On

2013-06-12