Incidental Mutation 'R6079:Tfe3'
ID482871
Institutional Source Beutler Lab
Gene Symbol Tfe3
Ensembl Gene ENSMUSG00000000134
Gene Nametranscription factor E3
SynonymsbHLHe33, Tcfe3, Tfe3, Tfe-3
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6079 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location7762560-7775202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7771049 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 231 (L231P)
Ref Sequence ENSEMBL: ENSMUSP00000111342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077680] [ENSMUST00000079542] [ENSMUST00000101695] [ENSMUST00000115677] [ENSMUST00000115678] [ENSMUST00000115679] [ENSMUST00000115680] [ENSMUST00000137467] [ENSMUST00000144900]
Predicted Effect unknown
Transcript: ENSMUST00000077680
AA Change: L371P
SMART Domains Protein: ENSMUSP00000076864
Gene: ENSMUSG00000000134
AA Change: L371P

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 112 265 1e-57 PFAM
HLH 351 404 2.72e-16 SMART
Pfam:DUF3371 431 571 4.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079542
AA Change: L336P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078498
Gene: ENSMUSG00000000134
AA Change: L336P

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
low complexity region 114 150 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
HLH 316 369 2.72e-16 SMART
Pfam:DUF3371 396 537 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101695
AA Change: L266P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099219
Gene: ENSMUSG00000000134
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 9 45 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
HLH 246 299 2.72e-16 SMART
Pfam:DUF3371 326 467 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115677
AA Change: L266P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111341
Gene: ENSMUSG00000000134
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 9 45 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
HLH 246 299 2.72e-16 SMART
Pfam:DUF3371 326 467 1.2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115678
AA Change: L231P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111342
Gene: ENSMUSG00000000134
AA Change: L231P

DomainStartEndE-ValueType
low complexity region 9 45 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
HLH 211 264 2.72e-16 SMART
Pfam:DUF3371 291 432 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115679
AA Change: L266P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111343
Gene: ENSMUSG00000000134
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 9 45 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
HLH 246 299 2.72e-16 SMART
Pfam:DUF3371 326 467 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133456
Predicted Effect probably benign
Transcript: ENSMUST00000137467
AA Change: L266P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134125
Gene: ENSMUSG00000000134
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 9 45 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
HLH 246 299 2.72e-16 SMART
Pfam:DUF3371 326 467 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144715
Predicted Effect probably benign
Transcript: ENSMUST00000144900
SMART Domains Protein: ENSMUSP00000120920
Gene: ENSMUSG00000000134

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
low complexity region 64 85 N/A INTRINSIC
low complexity region 94 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix domain-containing transcription factor that binds MUE3-type E-box sequences in the promoter of genes. The encoded protein promotes the expression of genes downstream of transforming growth factor beta (TGF-beta) signaling. This gene may be involved in chromosomal translocations in renal cell carcinomas and other cancers, resulting in the production of fusion proteins. Translocation partners include PRCC (papillary renal cell carcinoma), NONO (non-POU domain containing, octamer-binding), and ASPSCR1 (alveolar soft part sarcoma chromosome region, candidate 1), among other genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, normally pigmented, have normal eyes and mast cells, and show no evidence of osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Tfe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6078:Tfe3 UTSW X 7771049 missense probably damaging 0.98
U15987:Tfe3 UTSW X 7771049 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAAGTAAGCCGCAGAGCAG -3'
(R):5'- GACAGAGAGCTCTTTTGGGG -3'

Sequencing Primer
(F):5'- AGAGCAGGCGCACTTGC -3'
(R):5'- AGTCTCACTCTGTAGCCCAGGATAG -3'
Posted On2017-07-14