Incidental Mutation 'R6047:Mbd3l2'
ID483342
Institutional Source Beutler Lab
Gene Symbol Mbd3l2
Ensembl Gene ENSMUSG00000047508
Gene Namemethyl-CpG binding domain protein 3-like 2
Synonyms
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6047 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18430654-18446316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18444916 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 179 (H179L)
Ref Sequence ENSEMBL: ENSMUSP00000149130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051008] [ENSMUST00000213777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051008
AA Change: H179L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054515
Gene: ENSMUSG00000047508
AA Change: H179L

DomainStartEndE-ValueType
Pfam:MBDa 28 102 5.5e-28 PFAM
Pfam:MBD_C 105 212 2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213777
AA Change: H179L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Mbd3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1862:Mbd3l2 UTSW 9 18444921 missense possibly damaging 0.93
R1863:Mbd3l2 UTSW 9 18444921 missense possibly damaging 0.93
R2137:Mbd3l2 UTSW 9 18444958 missense probably damaging 1.00
R2138:Mbd3l2 UTSW 9 18444958 missense probably damaging 1.00
R2139:Mbd3l2 UTSW 9 18444958 missense probably damaging 1.00
R3853:Mbd3l2 UTSW 9 18444796 missense probably benign 0.27
R4726:Mbd3l2 UTSW 9 18444960 missense probably damaging 1.00
R6864:Mbd3l2 UTSW 9 18443499 splice site probably benign
R7302:Mbd3l2 UTSW 9 18444442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTGTCATGTCAATTGAAGC -3'
(R):5'- TCAAGAACTTACAGAGGCCTC -3'

Sequencing Primer
(F):5'- CCCTGTAGAAAGAATTGCACTG -3'
(R):5'- TTACAGAGGCCTCAACACTTG -3'
Posted On2017-07-14