Incidental Mutation 'R6047:Cdk9'
ID483331
Institutional Source Beutler Lab
Gene Symbol Cdk9
Ensembl Gene ENSMUSG00000009555
Gene Namecyclin-dependent kinase 9 (CDC2-related kinase)
SynonymsPITALRE
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6047 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32705784-32713076 bp(-) (GRCm38)
Type of Mutationunclassified (1885 bp from exon)
DNA Base Change (assembly) T to C at 32708273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009699] [ENSMUST00000120105] [ENSMUST00000123170] [ENSMUST00000127812] [ENSMUST00000143743] [ENSMUST00000146498] [ENSMUST00000154131] [ENSMUST00000155205]
Predicted Effect probably benign
Transcript: ENSMUST00000009699
AA Change: D257G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009699
Gene: ENSMUSG00000009555
AA Change: D257G

DomainStartEndE-ValueType
S_TKc 19 315 9.28e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120105
AA Change: D206G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113327
Gene: ENSMUSG00000009555
AA Change: D206G

DomainStartEndE-ValueType
Pfam:Pkinase 1 264 9.8e-58 PFAM
Pfam:Pkinase_Tyr 2 215 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125058
Predicted Effect probably benign
Transcript: ENSMUST00000127812
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130399
Predicted Effect probably benign
Transcript: ENSMUST00000143743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144210
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154131
SMART Domains Protein: ENSMUSP00000120857
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 19 61 8.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155205
SMART Domains Protein: ENSMUSP00000115299
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 1 54 8.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198213
Meta Mutation Damage Score 0.1281 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Cdk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Cdk9 APN 2 32708051 missense possibly damaging 0.77
R0321:Cdk9 UTSW 2 32712686 unclassified probably benign
R0615:Cdk9 UTSW 2 32709801 missense possibly damaging 0.92
R0624:Cdk9 UTSW 2 32709824 missense probably damaging 1.00
R0661:Cdk9 UTSW 2 32709820 missense probably damaging 1.00
R1525:Cdk9 UTSW 2 32710509 missense probably damaging 0.97
R2082:Cdk9 UTSW 2 32709501 missense probably damaging 1.00
R4416:Cdk9 UTSW 2 32708072 missense probably damaging 1.00
R7391:Cdk9 UTSW 2 32712071 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCAGAAGAAGTCGTGGTTG -3'
(R):5'- GCACATTTATCGCAGCTGAC -3'

Sequencing Primer
(F):5'- TGAGGGCATCGTCACTGTCAATC -3'
(R):5'- ACATTTATCGCAGCTGACTTGTG -3'
Posted On2017-07-14