Incidental Mutation 'R0520:Krtap19-2'
ID48486
Institutional Source Beutler Lab
Gene Symbol Krtap19-2
Ensembl Gene ENSMUSG00000057650
Gene Namekeratin associated protein 19-2
Synonyms
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location88873627-88874269 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 88873861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075284] [ENSMUST00000076186] [ENSMUST00000081334]
Predicted Effect probably benign
Transcript: ENSMUST00000075284
SMART Domains Protein: ENSMUSP00000133176
Gene: ENSMUSG00000060469

DomainStartEndE-ValueType
Pfam:KRTAP 1 56 4.4e-14 PFAM
Pfam:KRTAP 49 81 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000076186
AA Change: C132Y
SMART Domains Protein: ENSMUSP00000075543
Gene: ENSMUSG00000057650
AA Change: C132Y

DomainStartEndE-ValueType
Pfam:KRTAP 1 52 3e-11 PFAM
transmembrane domain 83 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081334
SMART Domains Protein: ENSMUSP00000132718
Gene: ENSMUSG00000060691

DomainStartEndE-ValueType
Pfam:KRTAP 1 57 9e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Krtap19-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03372:Krtap19-2 APN 16 88873886 unclassified probably benign
R4779:Krtap19-2 UTSW 16 88873874 unclassified probably benign
R5038:Krtap19-2 UTSW 16 88874028 nonsense probably null
R5533:Krtap19-2 UTSW 16 88874108 unclassified probably benign
R5810:Krtap19-2 UTSW 16 88874236 unclassified probably benign
X0028:Krtap19-2 UTSW 16 88874002 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTAGTGCCCAAGCTTAGGGTGCAG -3'
(R):5'- TCTGGCTATGGAGGCTACGGATAC -3'

Sequencing Primer
(F):5'- CCAAAGCTTCTTGGCTAGGA -3'
(R):5'- CGGATACGGCTCTGGCTATG -3'
Posted On2013-06-12