Mutagenetix > Incidental Mutation

Incidental Mutation 'R0520:Zic2'

66963

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038713-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R0520 (G1)

Quality Score

143

Status

Validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

small deletion (2 aa in frame mutation)

DNA Base Change (assembly)

CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075888

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	T	C	14: 103,288,952 (GRCm39)	I154T	possibly damaging	Het
Acr	G	T	15: 89,457,430 (GRCm39)	C226F	probably damaging	Het
Aff1	C	T	5: 103,995,617 (GRCm39)	R1070*	probably null	Het
Aldh9a1	C	T	1: 167,188,960 (GRCm39)		probably benign	Het
Apaf1	A	T	10: 90,915,851 (GRCm39)	H12Q	probably damaging	Het
Asic1	A	T	15: 99,593,416 (GRCm39)	I291F	probably damaging	Het
Aspm	T	A	1: 139,406,558 (GRCm39)	M1815K	possibly damaging	Het
Asxl3	A	T	18: 22,656,043 (GRCm39)	D1351V	probably damaging	Het
Atg9a	C	T	1: 75,163,178 (GRCm39)	W299*	probably null	Het
B3gntl1	C	A	11: 121,514,314 (GRCm39)	V313F	possibly damaging	Het
B4galnt4	T	A	7: 140,647,286 (GRCm39)	C345*	probably null	Het
Bicc1	A	T	10: 70,793,020 (GRCm39)	F211L	probably damaging	Het
Cachd1	T	G	4: 100,754,900 (GRCm39)	V117G	probably damaging	Het
Cdc16	G	A	8: 13,810,569 (GRCm39)		probably null	Het
Cers6	C	T	2: 68,935,435 (GRCm39)	Q312*	probably null	Het
Csta2	A	G	16: 36,073,461 (GRCm39)	I16V	probably benign	Het
Dclre1c	A	G	2: 3,437,512 (GRCm39)	H115R	probably damaging	Het
Ddx20	T	C	3: 105,594,692 (GRCm39)	T18A	probably benign	Het
Dhx57	A	G	17: 80,565,604 (GRCm39)	V816A	possibly damaging	Het
Dlgap1	C	T	17: 70,823,989 (GRCm39)	Q325*	probably null	Het
Dnaja1	A	T	4: 40,728,072 (GRCm39)	M178L	probably benign	Het
Ecd	A	T	14: 20,378,732 (GRCm39)	S454T	probably benign	Het
Efcab6	G	A	15: 83,834,247 (GRCm39)	H454Y	probably benign	Het
Exo1	T	A	1: 175,727,031 (GRCm39)	D447E	probably benign	Het
F5	T	G	1: 164,037,156 (GRCm39)	I1965S	probably benign	Het
Fbn2	A	G	18: 58,146,821 (GRCm39)	C2692R	probably damaging	Het
Fggy	T	A	4: 95,489,340 (GRCm39)	L152Q	probably damaging	Het
Glb1	ACCC	ACC	9: 114,250,812 (GRCm39)		probably null	Het
Gm9871	A	G	6: 101,778,540 (GRCm39)		noncoding transcript	Het
Gnai2	A	T	9: 107,497,372 (GRCm39)	D7E	probably benign	Het
Gon7	C	T	12: 102,724,047 (GRCm39)		probably benign	Het
H2-K2	A	T	17: 34,216,390 (GRCm39)	V272E	probably damaging	Het
Hectd4	G	T	5: 121,469,770 (GRCm39)	R2555L	possibly damaging	Het
Hexb	T	C	13: 97,317,618 (GRCm39)	R360G	probably benign	Het
Igsf9b	C	A	9: 27,234,546 (GRCm39)	S470R	probably benign	Het
Inpp5d	T	C	1: 87,633,642 (GRCm39)		probably benign	Het
Inpp5k	C	A	11: 75,530,356 (GRCm39)	Y265*	probably null	Het
Klhl33	T	G	14: 51,129,140 (GRCm39)	E436D	probably damaging	Het
Krt80	A	G	15: 101,267,898 (GRCm39)	L13P	probably benign	Het
Krtap19-2	C	T	16: 88,670,749 (GRCm39)		probably benign	Het
Marchf10	T	C	11: 105,280,708 (GRCm39)	T526A	probably benign	Het
Mcrs1	A	G	15: 99,146,336 (GRCm39)		probably null	Het
Msh2	G	T	17: 88,024,972 (GRCm39)	V617F	possibly damaging	Het
Nckap1	A	C	2: 80,371,874 (GRCm39)		probably benign	Het
Nek4	T	A	14: 30,681,263 (GRCm39)		probably benign	Het
Or7h8	G	A	9: 20,123,791 (GRCm39)	V49I	probably benign	Het
Or8b12b	T	C	9: 37,684,849 (GRCm39)	V298A	probably benign	Het
Or8k22	G	T	2: 86,163,475 (GRCm39)	T75K	probably damaging	Het
Or9s14	T	A	1: 92,536,471 (GRCm39)	V304E	probably damaging	Het
Osgin1	A	G	8: 120,169,247 (GRCm39)	H48R	probably damaging	Het
Pam	T	A	1: 97,811,920 (GRCm39)	T369S	probably benign	Het
Pclo	C	T	5: 14,763,844 (GRCm39)	Q821*	probably null	Het
Plekhm1	T	C	11: 103,285,770 (GRCm39)	I222V	probably benign	Het
Ptprg	T	G	14: 12,199,783 (GRCm38)	N65K	possibly damaging	Het
Pum2	T	A	12: 8,771,710 (GRCm39)	V351E	probably damaging	Het
Slc25a54	T	A	3: 109,014,546 (GRCm39)		probably benign	Het
Smchd1	A	T	17: 71,736,538 (GRCm39)	D587E	possibly damaging	Het
Stap1	A	G	5: 86,238,823 (GRCm39)	M164V	probably benign	Het
Stat5a	T	C	11: 100,752,252 (GRCm39)	V30A	probably damaging	Het
Stk36	T	G	1: 74,641,365 (GRCm39)		probably benign	Het
Tiam1	G	T	16: 89,614,839 (GRCm39)		probably benign	Het
Tmc5	T	C	7: 118,265,799 (GRCm39)	M553T	probably damaging	Het
Tmem14a	T	A	1: 21,299,636 (GRCm39)	Y89N	possibly damaging	Het
Tpp2	A	G	1: 44,029,690 (GRCm39)	Y991C	probably damaging	Het
Ttc7	A	G	17: 87,666,579 (GRCm39)	K615E	possibly damaging	Het
Ubac2	C	T	14: 122,231,754 (GRCm39)	P227S	probably damaging	Het
Vit	A	C	17: 78,932,588 (GRCm39)	K565T	probably damaging	Het
Vps13c	T	C	9: 67,853,133 (GRCm39)	F2409L	possibly damaging	Het
Wdr64	A	G	1: 175,553,958 (GRCm39)	T173A	probably damaging	Het
Zfp759	T	C	13: 67,285,419 (GRCm39)	I60T	probably benign	Het
Zfp81	A	G	17: 33,553,351 (GRCm39)	S488P	probably damaging	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0027:Zic2	UTSW	14	122,713,755 (GRCm39)	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0420:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0421:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0521:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8852:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19