Incidental Mutation 'R6030:Bbs7'
ID486178
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 044202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6030 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36602911 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably damaging
Transcript: ENSMUST00000040148
AA Change: D256G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: D256G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108155
AA Change: D256G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: D256G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108156
AA Change: D256G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: D256G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,255,733 W59R probably damaging Het
Abca16 A G 7: 120,533,798 N1317D probably benign Het
Abhd8 T A 8: 71,458,150 Y338F possibly damaging Het
Actg2 G T 6: 83,516,364 N297K probably damaging Het
Agap1 A G 1: 89,630,434 D148G probably damaging Het
Alox12 T C 11: 70,254,591 D52G possibly damaging Het
Ano5 T A 7: 51,574,825 S496T probably damaging Het
Arl6ip4 T C 5: 124,117,905 probably null Het
Atp4a G C 7: 30,722,516 E826Q probably damaging Het
Bckdha T A 7: 25,631,441 D50V probably damaging Het
Cast A G 13: 74,695,937 S693P possibly damaging Het
Col6a1 T C 10: 76,709,866 Y924C unknown Het
Crkl A G 16: 17,452,740 Y88C probably damaging Het
Cse1l T C 2: 166,919,621 F32L probably benign Het
Dmxl2 C T 9: 54,393,673 V2385I probably benign Het
Dnah1 T A 14: 31,268,027 I3219F probably damaging Het
Dnah17 C T 11: 118,025,549 R4266H probably benign Het
Efcab5 A G 11: 77,121,262 L722P probably damaging Het
Emilin3 C A 2: 160,909,185 V215L probably benign Het
Esr1 A T 10: 4,746,622 N157I possibly damaging Het
Esrrg A G 1: 188,198,707 M309V probably benign Het
Fam120b G A 17: 15,401,910 R50Q probably damaging Het
Fat2 G T 11: 55,310,303 Y648* probably null Het
Gbp2b T A 3: 142,603,653 I175N probably benign Het
Gm1043 T A 5: 37,154,608 probably benign Het
Gm21060 A G 19: 61,296,973 C33R possibly damaging Het
Gm9803 C T 10: 43,524,256 A30V probably benign Het
Gpx6 C T 13: 21,312,340 S28L probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifi44 T C 3: 151,749,558 Q10R probably benign Het
Impa2 T C 18: 67,318,428 V264A probably benign Het
Khdc1a A T 1: 21,350,884 M98L probably benign Het
Lrrc45 T A 11: 120,720,648 L616* probably null Het
Mios A T 6: 8,215,704 H300L probably benign Het
Mllt6 A T 11: 97,677,225 T827S probably damaging Het
Mrc1 C A 2: 14,316,901 D1068E probably benign Het
Ndst3 T C 3: 123,552,519 Y702C probably damaging Het
Nek11 T A 9: 105,204,888 probably null Het
Nek4 T C 14: 30,956,933 F138S probably damaging Het
Nfatc4 T A 14: 55,832,440 Y688* probably null Het
Nlrx1 C T 9: 44,263,760 V240M probably damaging Het
Npy6r A T 18: 44,276,082 Y190F probably benign Het
Olfr338 T G 2: 36,377,544 L256R probably damaging Het
Olfr472 A G 7: 107,903,413 E232G probably benign Het
Olfr509 A C 7: 108,646,226 S117A possibly damaging Het
Olfr548-ps1 C A 7: 102,542,610 R225S probably benign Het
Olfr780 A T 10: 129,322,369 T249S probably benign Het
Olfr960 T C 9: 39,623,341 F71L probably damaging Het
Osbpl7 A C 11: 97,052,261 H113P probably benign Het
Pck1 A G 2: 173,154,857 E188G probably benign Het
Pimreg A G 11: 72,045,750 D213G probably benign Het
Pkd1l2 A G 8: 117,043,237 I1160T probably damaging Het
Ppargc1b G A 18: 61,307,934 Q622* probably null Het
Ppfia2 T A 10: 106,906,477 C1044S probably damaging Het
Ppp4r3a A G 12: 101,058,400 V280A probably damaging Het
Ptprf T C 4: 118,211,048 N1764D probably benign Het
Pygm C T 19: 6,388,812 R311C possibly damaging Het
Rab7b A G 1: 131,698,561 K109R probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Sdccag3 T C 2: 26,386,971 D249G possibly damaging Het
Setbp1 T G 18: 78,857,711 I914L probably benign Het
Shprh A C 10: 11,151,991 Q114P probably benign Het
Slc5a9 T C 4: 111,885,528 I456V possibly damaging Het
Slc8b1 T C 5: 120,519,920 probably null Het
Spin1 T A 13: 51,139,516 Y87* probably null Het
Srebf2 T C 15: 82,177,276 probably null Het
Sufu T C 19: 46,475,539 Y397H probably damaging Het
Tgfb3 A C 12: 86,063,850 V242G probably benign Het
Tgm3 A T 2: 130,042,000 Y526F probably damaging Het
Tmem209 A G 6: 30,482,968 L508P probably damaging Het
Tmem67 T C 4: 12,063,799 D454G probably benign Het
Ttn T C 2: 76,816,599 E3280G possibly damaging Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Umps A G 16: 33,962,138 V138A probably benign Het
Wdr66 C T 5: 123,274,204 T532M probably damaging Het
Ypel1 A G 16: 17,084,513 probably null Het
Zdhhc19 T A 16: 32,499,042 L63Q probably null Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36610223 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCCAACAGTAAGTGTATAGTC -3'
(R):5'- CACCCAATTATGTGCAAAGTTGTTC -3'

Sequencing Primer
(F):5'- TCTACAGTACTGGGGCAGAAGC -3'
(R):5'- GGTTTCCTATCGCACCAC -3'
Posted On2017-08-16