Mutagenetix > Incidental Mutations

Incidental Mutation 'R6148:Bbs7'

488999

Institutional Source

Beutler Lab

Gene Symbol

Bbs7

Ensembl Gene

ENSMUSG00000037325

Gene Name

Bardet-Biedl syndrome 7 (human)

Synonyms

8430406N16Rik

MMRRC Submission

044295-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6148 (G1)

Quality Score

102.008

Status

Validated

Chromosome

Chromosomal Location

36573142-36613477 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 36613266 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 7 (R7L)

Ref Sequence

ENSEMBL: ENSMUSP00000118961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000142333]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040148
AA Change: R7L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: R7L

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108155
AA Change: R7L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: R7L

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108156
AA Change: R7L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: R7L

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129671

Predicted Effect

probably damaging
Transcript: ENSMUST00000142333
AA Change: R7L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118961
Gene: ENSMUSG00000037325
AA Change: R7L

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,187,426	C1067S	possibly damaging	Het
Agbl3	T	A	6: 34,857,753	S952R	possibly damaging	Het
Ano9	A	G	7: 141,106,785	Y429H	probably damaging	Het
Birc3	T	A	9: 7,849,683	D535V	possibly damaging	Het
Catsper4	A	G	4: 134,217,929	V206A	probably damaging	Het
Ccdc73	T	G	2: 104,992,137	S810R	possibly damaging	Het
Cd177	A	T	7: 24,744,273	L800*	probably null	Het
Cd34	T	C	1: 194,948,008		probably null	Het
Cep78	G	A	19: 15,981,786	R95*	probably null	Het
Cfap69	T	C	5: 5,663,996	D12G	probably benign	Het
Cpne7	A	G	8: 123,127,432	D286G	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cxcl5	A	T	5: 90,759,706	I46L	probably benign	Het
Cyp19a1	C	T	9: 54,180,256	G59D	probably damaging	Het
Dclre1c	A	G	2: 3,437,705	D35G	probably damaging	Het
Dvl1	A	G	4: 155,854,952	Y279C	probably damaging	Het
Fes	A	G	7: 80,380,296	L578P	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fmn2	T	C	1: 174,666,663	S1248P	probably damaging	Het
Fmo1	T	G	1: 162,851,519	S53R	probably damaging	Het
Gabrg1	A	T	5: 70,774,461	M313K	probably damaging	Het
Galnt10	T	C	11: 57,784,648	C578R	probably damaging	Het
Gm13178	T	C	4: 144,721,317	T30A	possibly damaging	Het
Gm15293	A	G	8: 21,202,412	N83S	probably benign	Het
Gpr39	T	C	1: 125,872,586	V358A	probably damaging	Het
Gsap	A	G	5: 21,226,325	R216G	probably damaging	Het
Gsap	A	T	5: 21,270,577	T570S	probably benign	Het
Gucy2d	A	T	7: 98,443,823	I136L	probably benign	Het
Hap1	A	T	11: 100,349,392	V294E	probably damaging	Het
Ipo8	A	G	6: 148,799,780	V514A	probably damaging	Het
Irf5	T	C	6: 29,535,959	L324P	probably damaging	Het
Itsn1	C	T	16: 91,816,852	R251C	probably damaging	Het
Klf11	T	C	12: 24,651,568		probably null	Het
Kpna6	G	A	4: 129,649,306	Q439*	probably null	Het
Mark4	A	T	7: 19,429,516	S563T	probably benign	Het
Mrpl21	A	T	19: 3,283,084	I5L	probably benign	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Myrf	G	A	19: 10,212,475	T815I	probably damaging	Het
Olfr1211	C	T	2: 88,930,253	V21I	probably benign	Het
Olfr515-ps1	A	T	7: 108,844,971		probably null	Het
Olfr665	A	G	7: 104,881,082	Y125C	possibly damaging	Het
Olfr743	A	G	14: 50,534,321	N303S	probably benign	Het
Olfr961	G	T	9: 39,647,259	D178Y	probably damaging	Het
Os9	T	C	10: 127,099,943	D280G	probably benign	Het
Pcdhb14	A	G	18: 37,449,230	N463S	probably damaging	Het
Pex19	G	A	1: 172,134,039	E271K	probably damaging	Het
Ppdpf	G	A	2: 181,187,848	S32N	probably benign	Het
Prdm2	A	G	4: 143,132,907	I1271T	probably benign	Het
Rbbp4	T	C	4: 129,321,958	T262A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sult1e1	A	T	5: 87,579,911	S171T	probably damaging	Het
Tns1	T	C	1: 73,953,453	T689A	probably damaging	Het
Unc13c	G	C	9: 73,693,366	N1365K	probably benign	Het
Vmn2r52	T	C	7: 10,171,163	I250V	probably benign	Het
Vmn2r55	C	A	7: 12,668,142	L406F	probably benign	Het
Wdcp	T	C	12: 4,850,621	V159A	possibly damaging	Het
Zbtb3	C	T	19: 8,804,196	A391V	probably benign	Het
Znhit1	A	T	5: 136,982,633	S109T	probably benign	Het

Other mutations in Bbs7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Bbs7	APN	3	36575287	makesense	probably null
IGL01533:Bbs7	APN	3	36610235	missense	possibly damaging	0.66
IGL01559:Bbs7	APN	3	36594510	missense	probably damaging	1.00
IGL01793:Bbs7	APN	3	36605682	critical splice donor site	probably null
IGL01867:Bbs7	APN	3	36573547	missense	probably benign	0.21
IGL01955:Bbs7	APN	3	36610322	missense	probably benign	0.16
IGL02207:Bbs7	APN	3	36604490	missense	probably benign	0.10
IGL02212:Bbs7	APN	3	36594409	missense	probably benign
IGL02451:Bbs7	APN	3	36610592	missense	possibly damaging	0.94
IGL03267:Bbs7	APN	3	36573505	missense	probably damaging	1.00
R0010:Bbs7	UTSW	3	36607717	splice site	probably null
R0243:Bbs7	UTSW	3	36605734	missense	probably benign
R0326:Bbs7	UTSW	3	36592376	missense	possibly damaging	0.46
R0372:Bbs7	UTSW	3	36602832	missense	probably benign	0.00
R0398:Bbs7	UTSW	3	36590717	missense	probably benign
R0453:Bbs7	UTSW	3	36607669	missense	possibly damaging	0.79
R0485:Bbs7	UTSW	3	36602873	missense	probably damaging	1.00
R0592:Bbs7	UTSW	3	36610297	missense	probably benign	0.05
R0619:Bbs7	UTSW	3	36607576	missense	probably benign	0.02
R0720:Bbs7	UTSW	3	36592423	missense	probably damaging	1.00
R0963:Bbs7	UTSW	3	36613263	missense	probably benign	0.22
R1177:Bbs7	UTSW	3	36610180	splice site	probably null
R1242:Bbs7	UTSW	3	36578427	missense	probably damaging	1.00
R1336:Bbs7	UTSW	3	36604444	missense	probably benign
R1401:Bbs7	UTSW	3	36573557	missense	probably benign	0.09
R1564:Bbs7	UTSW	3	36575795	missense	probably damaging	0.99
R2417:Bbs7	UTSW	3	36592397	missense	probably damaging	1.00
R3736:Bbs7	UTSW	3	36607670	missense	possibly damaging	0.87
R4282:Bbs7	UTSW	3	36573571	missense	probably damaging	1.00
R5412:Bbs7	UTSW	3	36599373	missense	probably benign
R5444:Bbs7	UTSW	3	36612050	missense	possibly damaging	0.50
R5932:Bbs7	UTSW	3	36582698	missense	probably benign	0.01
R6030:Bbs7	UTSW	3	36602911	missense	probably damaging	0.98
R6030:Bbs7	UTSW	3	36602911	missense	probably damaging	0.98
R6173:Bbs7	UTSW	3	36592374	nonsense	probably null
R6897:Bbs7	UTSW	3	36598311	missense	probably benign	0.07
R6912:Bbs7	UTSW	3	36605704	missense	probably benign	0.00
R7224:Bbs7	UTSW	3	36605728	missense	possibly damaging	0.48
R7268:Bbs7	UTSW	3	36604426	missense	probably benign
R7456:Bbs7	UTSW	3	36594378	missense	probably damaging	0.99
R7959:Bbs7	UTSW	3	36602936	missense	probably damaging	1.00
R8013:Bbs7	UTSW	3	36594387	missense	probably damaging	1.00
R8014:Bbs7	UTSW	3	36594387	missense	probably damaging	1.00
R8182:Bbs7	UTSW	3	36610223	missense	probably damaging	1.00
X0003:Bbs7	UTSW	3	36575845	nonsense	probably null
Z1177:Bbs7	UTSW	3	36602920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGTTCATTGAAATCTGGCTG -3'
(R):5'- TCAGAGCTGAAGGAACATGC -3'

Sequencing Primer
(F):5'- AAATCTGGCTGGTGTGGTCAG -3'
(R):5'- TTGCCTTGGAAACCGGC -3'

Posted On

2017-10-10