Incidental Mutation 'R7456:Bbs7'
ID578111
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7456 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36594378 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 407 (V407D)
Ref Sequence ENSEMBL: ENSMUSP00000047273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably damaging
Transcript: ENSMUST00000040148
AA Change: V407D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: V407D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108155
AA Change: V407D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: V407D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108156
AA Change: V407D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: V407D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,442,933 L612* probably null Het
9030624J02Rik C T 7: 118,804,117 P628S probably benign Het
Acer2 A G 4: 86,874,511 D8G possibly damaging Het
Angpt4 T C 2: 151,939,067 Y412H probably damaging Het
Ankef1 A G 2: 136,545,814 D217G probably benign Het
Ano2 A T 6: 125,963,545 I544F probably benign Het
App G A 16: 85,173,560 Het
Arhgef26 A G 3: 62,340,055 T187A probably benign Het
Axin1 T A 17: 26,143,165 V161E probably damaging Het
C1qtnf3 A T 15: 10,972,051 E141V probably benign Het
C2 A G 17: 34,864,582 I469T probably damaging Het
Cc2d1a A G 8: 84,140,239 probably null Het
Cd226 A T 18: 89,206,623 I10F probably damaging Het
Cep295nl T C 11: 118,333,550 K156R possibly damaging Het
Cfap44 A G 16: 44,431,942 T805A probably benign Het
Chd9 G T 8: 90,932,525 E38* probably null Het
Cldnd2 C T 7: 43,441,685 L14F not run Het
Cyp11b2 T C 15: 74,853,530 T247A probably benign Het
Dsc1 T C 18: 20,086,822 S764G probably benign Het
Dsg3 A T 18: 20,531,363 T473S probably benign Het
E330009J07Rik T G 6: 40,406,840 M423L probably benign Het
Fam193a A T 5: 34,420,788 I209F possibly damaging Het
Foxs1 T C 2: 152,933,125 K3E probably benign Het
Gabrr3 C T 16: 59,407,490 Q37* probably null Het
Gcm2 A T 13: 41,103,275 W333R probably benign Het
Gcn1l1 C T 5: 115,604,946 Q1559* probably null Het
Gfm2 A T 13: 97,145,703 K69* probably null Het
Gm14295 T G 2: 176,809,150 C144W possibly damaging Het
Gm32742 G A 9: 51,159,970 T5I probably damaging Het
Gm5093 T C 17: 46,439,753 D116G probably damaging Het
Gsn A T 2: 35,282,706 K3N possibly damaging Het
H2-M2 C T 17: 37,481,661 D240N possibly damaging Het
Habp2 G C 19: 56,319,525 G482R probably damaging Het
Hnrnpm A T 17: 33,646,648 Y680N possibly damaging Het
Hrc T A 7: 45,336,896 D490E possibly damaging Het
Impg2 A G 16: 56,259,913 I693M probably benign Het
Itga7 A G 10: 128,941,936 Y262C probably damaging Het
Kif1c A G 11: 70,728,598 T1020A probably benign Het
Kif23 T C 9: 61,937,120 I139V probably benign Het
Klk5 A G 7: 43,850,831 E281G probably benign Het
Kpna4 A G 3: 69,092,848 V275A probably damaging Het
Lamb2 C A 9: 108,485,780 D787E possibly damaging Het
Ldlrad3 A C 2: 101,954,925 V235G probably damaging Het
Maneal A G 4: 124,856,974 S330P probably damaging Het
Maz G A 7: 127,026,317 Q35* probably null Het
Mthfd1l C T 10: 4,089,998 T803M probably damaging Het
Muc5ac A G 7: 141,793,167 Q325R probably benign Het
Myo3a C A 2: 22,407,444 A758E probably benign Het
Ndufb7 A G 8: 83,566,853 D12G probably benign Het
Nsun2 T A 13: 69,633,606 C677S probably damaging Het
Obscn A G 11: 59,008,558 F6471S probably benign Het
Olfr1204 A T 2: 88,852,219 I90F probably damaging Het
Olfr639 A G 7: 104,011,838 V288A possibly damaging Het
Olfr851 T C 9: 19,497,548 S267P probably damaging Het
Otof T C 5: 30,394,661 D313G probably damaging Het
Paqr5 T C 9: 61,972,790 D74G probably benign Het
Pigq A G 17: 25,934,606 V365A unknown Het
Podn A T 4: 108,017,805 N588K probably benign Het
Polr3b G A 10: 84,622,491 G9R probably benign Het
Proser1 A G 3: 53,478,518 H607R probably damaging Het
Ryr2 C T 13: 11,752,282 V1241I probably benign Het
Sar1b G A 11: 51,791,354 A170T probably benign Het
Slc22a17 T C 14: 54,912,259 T191A probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,040 unknown Het
Slco6d1 A T 1: 98,421,357 D51V possibly damaging Het
Snx16 G A 3: 10,435,481 R143* probably null Het
Sytl2 T A 7: 90,348,847 L19Q probably damaging Het
Tmcc3 A G 10: 94,582,312 E345G possibly damaging Het
Ttn C T 2: 76,725,654 A30336T probably damaging Het
Vmn1r44 A G 6: 89,893,419 D49G probably benign Het
Vps41 T A 13: 18,864,034 D801E probably benign Het
Wif1 G A 10: 121,096,649 E311K probably benign Het
Zfp513 G T 5: 31,200,415 R207S possibly damaging Het
Zfp52 C A 17: 21,561,353 H488N probably damaging Het
Zfp738 A G 13: 67,669,500 Y791H probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36610223 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAAACTGAGGTTCAC -3'
(R):5'- GGTCTGAAATAGAACACCTGCAG -3'

Sequencing Primer
(F):5'- CCTGGAAACTGAGGTTCACTTATC -3'
(R):5'- ACCTGCAGTTTAAGGTGCTTCAG -3'
Posted On2019-10-07