Incidental Mutation 'R6031:Numa1'
ID486275
Institutional Source Beutler Lab
Gene Symbol Numa1
Ensembl Gene ENSMUSG00000066306
Gene Namenuclear mitotic apparatus protein 1
Synonyms6720401E04Rik
MMRRC Submission 044203-MU
Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6031 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location101934111-102014964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102012012 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1847 (D1847E)
Ref Sequence ENSEMBL: ENSMUSP00000081912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000094134] [ENSMUST00000163183] [ENSMUST00000209368] [ENSMUST00000209844] [ENSMUST00000211502]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084852
AA Change: D1847E

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: D1847E

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094134
SMART Domains Protein: ENSMUSP00000091685
Gene: ENSMUSG00000070427

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:IG 66 170 7e-54 BLAST
PDB:4EKX|A 71 167 6e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163183
AA Change: D494E

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306
AA Change: D494E

DomainStartEndE-ValueType
coiled coil region 7 73 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
SCOP:d1fxkc_ 164 290 7e-3 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 506 522 N/A INTRINSIC
PDB:3RO2|B 528 555 2e-10 PDB
low complexity region 720 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209583
Predicted Effect probably benign
Transcript: ENSMUST00000209844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210353
Predicted Effect probably benign
Transcript: ENSMUST00000211502
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]
Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,252 Y304H possibly damaging Het
Add2 A G 6: 86,098,673 E268G probably damaging Het
Akr1b3 A C 6: 34,312,674 V67G probably benign Het
Alms1 A T 6: 85,622,955 N1588Y probably damaging Het
Arhgap23 A T 11: 97,476,139 D1082V probably damaging Het
Asb6 A G 2: 30,824,195 V301A probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atg7 T A 6: 114,671,233 C31S probably benign Het
Camsap2 A T 1: 136,280,438 N1105K possibly damaging Het
Ccdc109b A G 3: 129,926,389 Y152H probably damaging Het
Ccdc125 C T 13: 100,684,369 probably null Het
Ccdc63 T C 5: 122,129,736 I56V possibly damaging Het
Cpd T C 11: 76,790,888 E1143G probably benign Het
Cpt1a T A 19: 3,371,556 probably null Het
Creb3l2 A T 6: 37,334,434 D473E probably benign Het
Disp2 G T 2: 118,789,794 V336L probably benign Het
Efr3b A G 12: 3,967,106 I782T possibly damaging Het
Fam98a A G 17: 75,539,432 V230A probably damaging Het
Fat3 T A 9: 15,988,492 T3082S probably benign Het
Frmd3 T C 4: 74,187,451 Y445H probably damaging Het
Galt G A 4: 41,757,202 R185Q probably benign Het
Gatb T C 3: 85,613,511 I309T possibly damaging Het
Gfi1b G A 2: 28,613,808 Q127* probably null Het
Gfpt1 C A 6: 87,086,320 T563N probably damaging Het
Gria1 A G 11: 57,217,782 D237G probably damaging Het
Hspbp1 A T 7: 4,663,466 V305D probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iars T C 13: 49,705,831 V9A probably damaging Het
Ipo4 G A 14: 55,632,139 P355S probably damaging Het
Jade2 G T 11: 51,826,586 C314* probably null Het
Kri1 T C 9: 21,275,269 E597G probably benign Het
Med23 C T 10: 24,903,748 R542* probably null Het
Ndc80 T C 17: 71,511,488 N291S probably benign Het
Nop2 T C 6: 125,133,566 probably null Het
Nrxn1 T C 17: 90,588,790 N984S probably damaging Het
Ntm A C 9: 29,009,375 L86R probably damaging Het
Odf2l A G 3: 145,139,863 Q334R probably damaging Het
Olfr1238 T A 2: 89,406,972 T36S probably damaging Het
Olfr1333 A T 4: 118,830,391 probably null Het
Olfr199 T C 16: 59,215,933 R227G probably benign Het
Olfr522 A T 7: 140,162,809 V47E possibly damaging Het
Olfr706 C T 7: 106,885,927 V297I possibly damaging Het
Olfr772 A G 10: 129,174,355 V222A probably benign Het
Pcdhb19 A T 18: 37,497,723 K190N probably damaging Het
Pdik1l A G 4: 134,279,041 F197L probably damaging Het
Rnf113a2 T C 12: 84,417,990 F219L probably damaging Het
Rnf208 A C 2: 25,243,764 T157P probably damaging Het
RP23-145I16.3 A T 7: 142,376,714 C364S probably damaging Het
Scn8a A T 15: 100,983,984 D644V probably damaging Het
Thbs3 T A 3: 89,218,094 C204S probably damaging Het
Tlr3 A G 8: 45,398,528 I444T probably damaging Het
Tmem206 A G 1: 191,340,840 R153G probably benign Het
Trpm8 A T 1: 88,354,469 I696F possibly damaging Het
Ttn A T 2: 76,830,597 V7422D possibly damaging Het
Ufl1 A G 4: 25,278,038 V139A probably benign Het
Uggt2 A T 14: 119,070,826 V381D probably benign Het
Vgll3 T A 16: 65,839,481 Y173N probably damaging Het
Vmn1r9 A G 6: 57,071,173 T78A probably benign Het
Vps13b T A 15: 35,471,968 L806M probably damaging Het
Vps13d A C 4: 145,168,509 H394Q probably benign Het
Wdr53 T A 16: 32,256,718 V247D probably damaging Het
Wdr81 A T 11: 75,447,869 L1488Q probably damaging Het
Zc3h6 A G 2: 128,967,812 D3G possibly damaging Het
Zfp93 G T 7: 24,276,300 C570F probably damaging Het
Zfp943 C T 17: 21,993,376 T481I probably benign Het
Other mutations in Numa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Numa1 APN 7 102013286 missense possibly damaging 0.95
IGL00819:Numa1 APN 7 101992710 missense possibly damaging 0.90
IGL01103:Numa1 APN 7 102001571 missense probably benign 0.01
IGL01153:Numa1 APN 7 101994744 missense probably damaging 1.00
IGL01954:Numa1 APN 7 101996093 nonsense probably null
IGL02114:Numa1 APN 7 102011876 unclassified probably benign
IGL02245:Numa1 APN 7 102000394 missense probably benign 0.02
IGL02259:Numa1 APN 7 101987748 missense possibly damaging 0.93
IGL02313:Numa1 APN 7 102000232 nonsense probably null
IGL02316:Numa1 APN 7 102001370 missense probably damaging 1.00
IGL02386:Numa1 APN 7 102007532 missense probably benign 0.00
IGL02517:Numa1 APN 7 102012009 missense probably benign 0.01
IGL02529:Numa1 APN 7 101999953 splice site probably null
IGL02664:Numa1 APN 7 101998902 missense possibly damaging 0.83
IGL02721:Numa1 APN 7 101999911 missense probably benign 0.01
IGL02816:Numa1 APN 7 101996100 missense probably damaging 1.00
IGL03126:Numa1 APN 7 102000667 nonsense probably null
meltdown UTSW 7 101990571 critical splice acceptor site probably null
1mM(1):Numa1 UTSW 7 101994715 missense probably benign 0.06
PIT4651001:Numa1 UTSW 7 102013934 missense probably damaging 0.97
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0548:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0554:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0592:Numa1 UTSW 7 102013897 missense probably benign
R0669:Numa1 UTSW 7 101999677 missense probably benign
R0856:Numa1 UTSW 7 101998948 missense probably damaging 1.00
R1072:Numa1 UTSW 7 102001150 splice site probably null
R1776:Numa1 UTSW 7 102011050 missense probably damaging 1.00
R1898:Numa1 UTSW 7 101992720 critical splice donor site probably null
R1969:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1970:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1971:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R2180:Numa1 UTSW 7 101999990 missense probably benign 0.00
R2256:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2257:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2508:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R2958:Numa1 UTSW 7 102009495 missense possibly damaging 0.92
R4210:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4211:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4643:Numa1 UTSW 7 102000665 splice site probably null
R4783:Numa1 UTSW 7 102013566 missense probably damaging 1.00
R4823:Numa1 UTSW 7 101996037 missense probably damaging 1.00
R4908:Numa1 UTSW 7 102012805 missense probably damaging 1.00
R4934:Numa1 UTSW 7 102010857 missense probably benign 0.32
R4981:Numa1 UTSW 7 101992674 missense probably damaging 1.00
R5120:Numa1 UTSW 7 101977437 missense probably damaging 0.99
R5122:Numa1 UTSW 7 102013769 missense probably damaging 1.00
R5210:Numa1 UTSW 7 101999981 missense probably benign 0.03
R5230:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R5547:Numa1 UTSW 7 102013930 missense probably damaging 1.00
R5861:Numa1 UTSW 7 102009287 splice site probably null
R6006:Numa1 UTSW 7 101992719 critical splice donor site probably null
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6295:Numa1 UTSW 7 102000767 missense probably benign 0.03
R6322:Numa1 UTSW 7 102000920 missense probably damaging 1.00
R6413:Numa1 UTSW 7 101990571 critical splice acceptor site probably null
R6786:Numa1 UTSW 7 101992638 missense probably benign 0.05
R7218:Numa1 UTSW 7 102000910 missense probably benign 0.02
R7312:Numa1 UTSW 7 101990599 missense possibly damaging 0.92
R7374:Numa1 UTSW 7 102009128 missense probably benign 0.00
R7626:Numa1 UTSW 7 101999423 missense probably benign 0.42
R7769:Numa1 UTSW 7 101999000 missense possibly damaging 0.77
R7830:Numa1 UTSW 7 101999285 missense probably benign 0.03
R7886:Numa1 UTSW 7 102013865 missense probably benign 0.27
R7935:Numa1 UTSW 7 102002331 missense probably damaging 0.96
R8134:Numa1 UTSW 7 102001627 missense probably benign 0.14
R8143:Numa1 UTSW 7 101999684 missense possibly damaging 0.82
R8217:Numa1 UTSW 7 101992669 missense possibly damaging 0.66
R8263:Numa1 UTSW 7 101999284 missense probably benign 0.03
RF013:Numa1 UTSW 7 101999780 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998331 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998402 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTTTCCATACGCAGTGTAAAGC -3'
(R):5'- GGAAGCTTGCCTCTTTTCCAG -3'

Sequencing Primer
(F):5'- CAGTGTAAAGCAGTGTGGTATC -3'
(R):5'- AGGCCAAGATTTGCTTCCAG -3'
Posted On2017-08-16