Incidental Mutation 'R6132:1110017D15Rik'
ID 487168
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene Name RIKEN cDNA 1110017D15 gene
Synonyms Smrp1, Cbe1
MMRRC Submission 044279-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6132 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 41505009-41517333 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) C to T at 41517160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000092744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126] [ENSMUST00000108049] [ENSMUST00000108050] [ENSMUST00000108052]
AlphaFold Q2MH31
Predicted Effect probably null
Transcript: ENSMUST00000030152
AA Change: M1I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441
AA Change: M1I

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095126
AA Change: M1I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: M1I

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108049
SMART Domains Protein: ENSMUSP00000103684
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 157 2.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108050
SMART Domains Protein: ENSMUSP00000103685
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 156 8.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108052
SMART Domains Protein: ENSMUSP00000103687
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 37 168 1.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151164
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41,507,178 (GRCm38) missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41,511,433 (GRCm38) missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41,517,080 (GRCm38) missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41,507,287 (GRCm38) missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41,507,538 (GRCm38) missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41,507,330 (GRCm38) critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41,507,223 (GRCm38) missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41,507,519 (GRCm38) critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41,507,170 (GRCm38) missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41,517,200 (GRCm38) unclassified probably benign
R5132:1110017D15Rik UTSW 4 41,517,178 (GRCm38) unclassified probably benign
R6413:1110017D15Rik UTSW 4 41,505,135 (GRCm38) missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41,505,071 (GRCm38) missense possibly damaging 0.93
R9493:1110017D15Rik UTSW 4 41,508,614 (GRCm38) missense
R9594:1110017D15Rik UTSW 4 41,505,091 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- ATGTCCAAATGCCAGCTGCC -3'
(R):5'- CCTATCCTAAAAGGGAAGTTGGG -3'

Sequencing Primer
(F):5'- CAAACTTGTTGGCTTCCC -3'
(R):5'- GTTGGGTGGGGTAGGAAAC -3'
Posted On 2017-10-10