Incidental Mutation 'R0284:1110017D15Rik'
ID24595
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41507538 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 150 (E150A)
Ref Sequence ENSEMBL: ENSMUSP00000092744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000149596]
Predicted Effect probably damaging
Transcript: ENSMUST00000030152
AA Change: E150A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441
AA Change: E150A

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095126
AA Change: E150A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: E150A

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124019
Predicted Effect unknown
Transcript: ENSMUST00000125303
AA Change: E68A
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: E68A

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138217
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41505071 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTCCAGGATACCCAAAGAACCAG -3'
(R):5'- AGGCGGAGTAAATGTGTTGCCC -3'

Sequencing Primer
(F):5'- CCCAAAGAACCAGTGTCAGAGG -3'
(R):5'- TGTTCCGCCTGAAAGACAGTC -3'
Posted On2013-04-16