Incidental Mutation 'R8519:1110017D15Rik'
ID658514
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8519 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41505071 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 214 (S214P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000149596]
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125303
AA Change: S214P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: S214P

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,773,236 D338G probably damaging Het
Adamts14 T C 10: 61,202,840 T964A possibly damaging Het
Adamts7 G A 9: 90,193,557 W1156* probably null Het
Adcy9 T C 16: 4,288,128 I1041V possibly damaging Het
Art4 C A 6: 136,854,351 probably null Het
Bcl9 A G 3: 97,209,018 S787P probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Cdc45 T C 16: 18,808,847 N76S probably damaging Het
Cdon A G 9: 35,478,654 D868G probably damaging Het
Cldn10 T G 14: 118,855,027 V13G probably benign Het
Cnot6 G T 11: 49,685,114 Q178K probably benign Het
Crot T C 5: 8,973,629 I420V probably benign Het
Csgalnact1 T A 8: 68,401,453 H232L possibly damaging Het
Cuzd1 T C 7: 131,308,897 I556M possibly damaging Het
Cyp2c54 G A 19: 40,038,413 R433W probably damaging Het
Cyp2j11 A G 4: 96,319,302 F259L probably benign Het
Dhx9 C T 1: 153,473,176 G264R probably damaging Het
Dnah5 G A 15: 28,299,099 V1536M probably benign Het
Erlin1 T A 19: 44,069,602 probably benign Het
Foxb2 C A 19: 16,872,983 V220L possibly damaging Het
Gigyf2 A T 1: 87,410,709 T388S probably benign Het
Gimap5 T C 6: 48,753,134 C213R probably benign Het
Gkap1 T G 13: 58,238,692 K57N probably damaging Het
Gm10696 T C 3: 94,176,190 M105V probably benign Het
Gm14139 A G 2: 150,192,780 I340M probably benign Het
Gm15922 T C 7: 3,737,433 Q263R probably benign Het
H60b T G 10: 22,283,522 probably benign Het
Hectd4 C T 5: 121,304,426 R670* probably null Het
Hoxc9 A G 15: 102,983,909 N185D probably damaging Het
Igkv1-117 A G 6: 68,121,782 E105G possibly damaging Het
Klk10 T A 7: 43,782,815 Y57* probably null Het
Lrrc63 A T 14: 75,125,872 I273K possibly damaging Het
M6pr T C 6: 122,315,066 I119T probably damaging Het
Mael T C 1: 166,235,558 probably null Het
Magi1 A G 6: 93,704,349 S574P possibly damaging Het
Man2c1 A G 9: 57,136,777 D291G probably benign Het
Mapk1ip1l A T 14: 47,310,463 probably benign Het
Mrc2 A G 11: 105,347,306 T1135A possibly damaging Het
Mrpl39 A G 16: 84,730,848 V164A probably benign Het
Mynn C A 3: 30,607,141 P124H probably damaging Het
Olfr267 A G 4: 58,785,203 I173T probably damaging Het
Olfr300-ps1 A T 7: 86,443,854 N291I probably damaging Het
Olfr323 T G 11: 58,625,974 Q23P probably damaging Het
Olfr330 A G 11: 58,529,503 F161S possibly damaging Het
Olfr420 A G 1: 174,159,048 I92V probably damaging Het
Pcif1 A G 2: 164,884,383 N68S probably damaging Het
Pcm1 T A 8: 41,275,939 N649K probably damaging Het
Plxna2 T A 1: 194,793,958 I1162N probably damaging Het
Pnp2 T A 14: 50,964,385 L276Q probably damaging Het
Sirpb1c T A 3: 15,848,362 I18F possibly damaging Het
Slc2a12 A T 10: 22,664,779 M178L probably damaging Het
Slc35c1 G T 2: 92,454,707 F187L probably benign Het
Smg1 T C 7: 118,171,759 probably benign Het
Stn1 T C 19: 47,501,672 H342R probably benign Het
Sult1c1 A T 17: 53,969,681 H117Q probably damaging Het
Thap1 G A 8: 26,160,897 R42K probably damaging Het
Tpp2 A T 1: 43,977,205 probably null Het
Trib2 G T 12: 15,815,346 P76Q probably damaging Het
Ttc24 G T 3: 88,073,062 Q111K probably damaging Het
Ubr4 T C 4: 139,416,647 S1401P probably damaging Het
Uggt1 A C 1: 36,176,643 probably null Het
Ugt2b1 A G 5: 86,926,467 L11S probably damaging Het
Uso1 T G 5: 92,195,363 S769A probably benign Het
Vmn2r117 T C 17: 23,479,468 T44A probably benign Het
Vmn2r28 T A 7: 5,486,348 L497F probably benign Het
Vsig10l G A 7: 43,464,902 S318N probably benign Het
Wbp4 A G 14: 79,476,823 L83P probably damaging Het
Wnk1 G A 6: 119,950,083 R1510W probably damaging Het
Zc3hav1l C T 6: 38,295,241 V198M probably damaging Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATCTGGATGGTTAGGGGAACTC -3'
(R):5'- CAGTGATCGGTCAGTGTCAG -3'

Sequencing Primer
(F):5'- GATGGTTAGGGGAACTCATCTC -3'
(R):5'- TCAGTGTCAGAGATAAAACGCTG -3'
Posted On2021-01-18