Incidental Mutation 'R6141:Tlr1'
ID 488572
Institutional Source Beutler Lab
Gene Symbol Tlr1
Ensembl Gene ENSMUSG00000044827
Gene Name toll-like receptor 1
Synonyms
MMRRC Submission 044288-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6141 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 64924679-64933563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64925213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 674 (R674G)
Ref Sequence ENSEMBL: ENSMUSP00000142500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]
AlphaFold Q9EPQ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000059349
AA Change: R674G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: R674G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197315
AA Change: R674G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: R674G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
Pfam:LRR_1 97 114 2.3e-2 PFAM
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Meta Mutation Damage Score 0.3278 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A T 7: 42,448,059 C4S probably damaging Het
Abhd5 A T 9: 122,377,933 T95S probably benign Het
Ambra1 A T 2: 91,875,754 N795Y probably damaging Het
Brca2 A G 5: 150,540,637 N1289D possibly damaging Het
Cavin2 T C 1: 51,300,938 L258P probably damaging Het
Ccdc110 A G 8: 45,941,770 T233A possibly damaging Het
Ccdc14 T A 16: 34,706,562 I279N probably damaging Het
Cntn5 A T 9: 10,144,157 L169Q probably benign Het
Dbf4 T C 5: 8,408,545 S157G possibly damaging Het
Defb22 A T 2: 152,485,802 N154K unknown Het
Eepd1 T A 9: 25,482,984 D181E probably benign Het
Etfa T C 9: 55,464,819 H286R probably damaging Het
Gm44419 T A 6: 65,150,956 noncoding transcript Het
Gpatch4 C T 3: 88,054,740 R155* probably null Het
Grik1 T G 16: 87,896,872 R862S probably benign Het
Hectd1 A C 12: 51,746,092 probably null Het
Ift122 T C 6: 115,916,011 W919R probably damaging Het
Iqgap2 A T 13: 95,721,686 probably null Het
Kcnq4 A T 4: 120,715,869 I245N probably damaging Het
Map3k3 G T 11: 106,097,048 R21L probably benign Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Msr1 A T 8: 39,631,319 V65E probably damaging Het
Myom2 A T 8: 15,063,903 D17V probably damaging Het
Naaladl1 T A 19: 6,109,755 probably null Het
Naip6 T C 13: 100,308,233 Y239C possibly damaging Het
Nckap1 C A 2: 80,530,207 D533Y probably damaging Het
Ndufs2 T C 1: 171,236,616 E375G probably damaging Het
Nsd1 T C 13: 55,291,284 V1605A probably damaging Het
Olfr1290 A G 2: 111,490,119 I13T probably benign Het
Olfr1468-ps1 A T 19: 13,375,283 Y107F probably benign Het
Olfr199 T A 16: 59,216,553 H20L probably benign Het
Olfr629 C A 7: 103,740,787 R151L probably damaging Het
Olfr872 T A 9: 20,260,458 M206K probably benign Het
Pcp2 G A 8: 3,623,543 probably null Het
Pdgfra A G 5: 75,173,396 S377G probably damaging Het
Pqlc2 A G 4: 139,300,245 V262A probably benign Het
Reep5 A T 18: 34,372,458 Y53* probably null Het
Ric1 T C 19: 29,595,442 S761P probably damaging Het
Satb1 T C 17: 51,775,376 T417A possibly damaging Het
Slc1a7 T A 4: 108,002,182 M156K possibly damaging Het
Slc4a10 A G 2: 62,211,445 E123G probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Stard13 A T 5: 151,042,242 V916E probably damaging Het
Tnfsf11 A G 14: 78,307,859 Y11H probably damaging Het
Tnr T A 1: 159,887,122 V857E probably benign Het
Tubgcp5 A G 7: 55,806,778 I373V probably benign Het
Ush2a A T 1: 188,357,963 R414S possibly damaging Het
Vmn2r100 T C 17: 19,522,314 S317P probably benign Het
Wdr49 A T 3: 75,323,682 F558I probably benign Het
Zfyve16 A G 13: 92,511,597 I983T probably benign Het
Other mutations in Tlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tlr1 APN 5 64926434 missense probably benign 0.01
IGL01324:Tlr1 APN 5 64925179 missense probably damaging 1.00
IGL01564:Tlr1 APN 5 64925846 missense probably damaging 1.00
IGL01663:Tlr1 APN 5 64925073 missense possibly damaging 0.48
IGL01689:Tlr1 APN 5 64925779 missense probably damaging 0.97
IGL01749:Tlr1 APN 5 64925947 nonsense probably null
IGL01751:Tlr1 APN 5 64925947 nonsense probably null
IGL01769:Tlr1 APN 5 64925947 nonsense probably null
IGL01899:Tlr1 APN 5 64927016 missense probably damaging 0.97
IGL02197:Tlr1 APN 5 64926454 missense probably damaging 1.00
IGL02295:Tlr1 APN 5 64925947 nonsense probably null
IGL02308:Tlr1 APN 5 64925947 nonsense probably null
IGL02309:Tlr1 APN 5 64925947 nonsense probably null
IGL02311:Tlr1 APN 5 64925947 nonsense probably null
IGL02591:Tlr1 APN 5 64926716 missense probably damaging 1.00
IGL02739:Tlr1 APN 5 64927126 missense probably benign 0.41
IGL03206:Tlr1 APN 5 64925057 missense probably damaging 0.99
IGL03055:Tlr1 UTSW 5 64926596 missense probably benign 0.05
R0315:Tlr1 UTSW 5 64926928 missense probably damaging 0.99
R0317:Tlr1 UTSW 5 64925967 nonsense probably null
R0511:Tlr1 UTSW 5 64926620 missense probably damaging 0.98
R1539:Tlr1 UTSW 5 64926976 missense probably damaging 1.00
R1552:Tlr1 UTSW 5 64926860 missense probably damaging 1.00
R1835:Tlr1 UTSW 5 64925700 missense probably benign 0.01
R1933:Tlr1 UTSW 5 64925438 missense possibly damaging 0.94
R1956:Tlr1 UTSW 5 64925177 missense probably damaging 1.00
R2099:Tlr1 UTSW 5 64925068 missense probably damaging 1.00
R2507:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2508:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2937:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R2938:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R3033:Tlr1 UTSW 5 64925569 missense probably damaging 1.00
R4164:Tlr1 UTSW 5 64927202 missense possibly damaging 0.47
R4226:Tlr1 UTSW 5 64925717 missense probably damaging 0.96
R4366:Tlr1 UTSW 5 64925837 missense probably benign 0.00
R5009:Tlr1 UTSW 5 64926224 missense probably damaging 1.00
R5029:Tlr1 UTSW 5 64925681 missense probably damaging 0.97
R5069:Tlr1 UTSW 5 64926400 missense probably benign 0.01
R5186:Tlr1 UTSW 5 64925221 missense probably damaging 1.00
R5336:Tlr1 UTSW 5 64925802 missense probably damaging 1.00
R5500:Tlr1 UTSW 5 64927098 missense probably benign 0.08
R5503:Tlr1 UTSW 5 64926292 missense probably damaging 0.99
R5577:Tlr1 UTSW 5 64926085 missense possibly damaging 0.94
R6210:Tlr1 UTSW 5 64925286 missense probably damaging 1.00
R6238:Tlr1 UTSW 5 64927129 missense possibly damaging 0.86
R6284:Tlr1 UTSW 5 64927099 missense possibly damaging 0.93
R6311:Tlr1 UTSW 5 64926845 missense probably damaging 0.99
R7021:Tlr1 UTSW 5 64925713 missense possibly damaging 0.75
R7140:Tlr1 UTSW 5 64925678 missense probably benign 0.01
R7234:Tlr1 UTSW 5 64926724 missense probably damaging 0.96
R7278:Tlr1 UTSW 5 64926772 missense probably benign 0.03
R7378:Tlr1 UTSW 5 64925228 missense not run
R7652:Tlr1 UTSW 5 64926787 nonsense probably null
R7781:Tlr1 UTSW 5 64926736 missense possibly damaging 0.94
R7783:Tlr1 UTSW 5 64924921 missense probably damaging 1.00
R7851:Tlr1 UTSW 5 64924964 missense possibly damaging 0.58
R8546:Tlr1 UTSW 5 64927031 missense probably damaging 0.99
R8696:Tlr1 UTSW 5 64926751 missense probably benign 0.00
R8744:Tlr1 UTSW 5 64926530 missense possibly damaging 0.77
R9086:Tlr1 UTSW 5 64925855 missense probably damaging 1.00
R9160:Tlr1 UTSW 5 64926310 missense probably benign 0.00
R9199:Tlr1 UTSW 5 64926191 missense possibly damaging 0.87
R9778:Tlr1 UTSW 5 64926028 missense probably damaging 1.00
X0067:Tlr1 UTSW 5 64926575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTTCGTGACATGAGAG -3'
(R):5'- AGGATGCTGTGTCAGTGGAC -3'

Sequencing Primer
(F):5'- CCAGCAAGATGAGGATTAAGTTATC -3'
(R):5'- TCAGTGGACACAGACCAGGC -3'
Posted On 2017-10-10