Mutagenetix > Incidental Mutation

Incidental Mutation 'R5503:Tlr1'

430726

Institutional Source

Beutler Lab

Gene Symbol

Tlr1

Ensembl Gene

ENSMUSG00000044827

Gene Name

toll-like receptor 1

Synonyms

MMRRC Submission

043064-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64924679-64933563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64926292 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 314 (V314D)

Ref Sequence

ENSEMBL: ENSMUSP00000142500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]

AlphaFold

Q9EPQ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000059349
AA Change: V314D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: V314D

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000197315
AA Change: V314D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: V314D

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
Pfam:LRR_1	97	114	2.3e-2	PFAM
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Tlr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Tlr1	APN	5	64926434	missense	probably benign	0.01
IGL01324:Tlr1	APN	5	64925179	missense	probably damaging	1.00
IGL01564:Tlr1	APN	5	64925846	missense	probably damaging	1.00
IGL01663:Tlr1	APN	5	64925073	missense	possibly damaging	0.48
IGL01689:Tlr1	APN	5	64925779	missense	probably damaging	0.97
IGL01749:Tlr1	APN	5	64925947	nonsense	probably null
IGL01751:Tlr1	APN	5	64925947	nonsense	probably null
IGL01769:Tlr1	APN	5	64925947	nonsense	probably null
IGL01899:Tlr1	APN	5	64927016	missense	probably damaging	0.97
IGL02197:Tlr1	APN	5	64926454	missense	probably damaging	1.00
IGL02295:Tlr1	APN	5	64925947	nonsense	probably null
IGL02308:Tlr1	APN	5	64925947	nonsense	probably null
IGL02309:Tlr1	APN	5	64925947	nonsense	probably null
IGL02311:Tlr1	APN	5	64925947	nonsense	probably null
IGL02591:Tlr1	APN	5	64926716	missense	probably damaging	1.00
IGL02739:Tlr1	APN	5	64927126	missense	probably benign	0.41
IGL03206:Tlr1	APN	5	64925057	missense	probably damaging	0.99
IGL03055:Tlr1	UTSW	5	64926596	missense	probably benign	0.05
R0315:Tlr1	UTSW	5	64926928	missense	probably damaging	0.99
R0317:Tlr1	UTSW	5	64925967	nonsense	probably null
R0511:Tlr1	UTSW	5	64926620	missense	probably damaging	0.98
R1539:Tlr1	UTSW	5	64926976	missense	probably damaging	1.00
R1552:Tlr1	UTSW	5	64926860	missense	probably damaging	1.00
R1835:Tlr1	UTSW	5	64925700	missense	probably benign	0.01
R1933:Tlr1	UTSW	5	64925438	missense	possibly damaging	0.94
R1956:Tlr1	UTSW	5	64925177	missense	probably damaging	1.00
R2099:Tlr1	UTSW	5	64925068	missense	probably damaging	1.00
R2507:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2508:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2937:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R2938:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R3033:Tlr1	UTSW	5	64925569	missense	probably damaging	1.00
R4164:Tlr1	UTSW	5	64927202	missense	possibly damaging	0.47
R4226:Tlr1	UTSW	5	64925717	missense	probably damaging	0.96
R4366:Tlr1	UTSW	5	64925837	missense	probably benign	0.00
R5009:Tlr1	UTSW	5	64926224	missense	probably damaging	1.00
R5029:Tlr1	UTSW	5	64925681	missense	probably damaging	0.97
R5069:Tlr1	UTSW	5	64926400	missense	probably benign	0.01
R5186:Tlr1	UTSW	5	64925221	missense	probably damaging	1.00
R5336:Tlr1	UTSW	5	64925802	missense	probably damaging	1.00
R5500:Tlr1	UTSW	5	64927098	missense	probably benign	0.08
R5577:Tlr1	UTSW	5	64926085	missense	possibly damaging	0.94
R6141:Tlr1	UTSW	5	64925213	missense	possibly damaging	0.92
R6210:Tlr1	UTSW	5	64925286	missense	probably damaging	1.00
R6238:Tlr1	UTSW	5	64927129	missense	possibly damaging	0.86
R6284:Tlr1	UTSW	5	64927099	missense	possibly damaging	0.93
R6311:Tlr1	UTSW	5	64926845	missense	probably damaging	0.99
R7021:Tlr1	UTSW	5	64925713	missense	possibly damaging	0.75
R7140:Tlr1	UTSW	5	64925678	missense	probably benign	0.01
R7234:Tlr1	UTSW	5	64926724	missense	probably damaging	0.96
R7278:Tlr1	UTSW	5	64926772	missense	probably benign	0.03
R7378:Tlr1	UTSW	5	64925228	missense	not run
R7652:Tlr1	UTSW	5	64926787	nonsense	probably null
R7781:Tlr1	UTSW	5	64926736	missense	possibly damaging	0.94
R7783:Tlr1	UTSW	5	64924921	missense	probably damaging	1.00
R7851:Tlr1	UTSW	5	64924964	missense	possibly damaging	0.58
R8546:Tlr1	UTSW	5	64927031	missense	probably damaging	0.99
R8696:Tlr1	UTSW	5	64926751	missense	probably benign	0.00
R8744:Tlr1	UTSW	5	64926530	missense	possibly damaging	0.77
R9086:Tlr1	UTSW	5	64925855	missense	probably damaging	1.00
R9160:Tlr1	UTSW	5	64926310	missense	probably benign	0.00
R9199:Tlr1	UTSW	5	64926191	missense	possibly damaging	0.87
R9778:Tlr1	UTSW	5	64926028	missense	probably damaging	1.00
X0067:Tlr1	UTSW	5	64926575	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCTGTACCTTAGAGAATTCTGG -3'
(R):5'- TGGAAACAACGTGGAATTCCTTC -3'

Sequencing Primer
(F):5'- ACCTTAGAGAATTCTGGCTAATGTC -3'
(R):5'- CATTAATATCCTCCAGATAGTTTGGC -3'

Posted On

2016-10-05