Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Tlr1'

205153

Institutional Source

Beutler Lab

Gene Symbol

Tlr1

Ensembl Gene

ENSMUSG00000044827

Gene Name

toll-like receptor 1

Synonyms

MMRRC Submission

039862-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64924679-64933563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64925700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 511 (D511E)

Ref Sequence

ENSEMBL: ENSMUSP00000142500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]

AlphaFold

Q9EPQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000059349
AA Change: D511E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: D511E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197315
AA Change: D511E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: D511E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
Pfam:LRR_1	97	114	2.3e-2	PFAM
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cep192	T	A	18: 67,804,424	S75T	possibly damaging	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Herc2	G	T	7: 56,206,765	G3918*	probably null	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Llgl1	A	G	11: 60,704,730	M81V	probably benign	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Virma	T	C	4: 11,540,511	S1471P	probably benign	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Vps13c	T	A	9: 67,993,013	F3671L	probably benign	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Tlr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Tlr1	APN	5	64926434	missense	probably benign	0.01
IGL01324:Tlr1	APN	5	64925179	missense	probably damaging	1.00
IGL01564:Tlr1	APN	5	64925846	missense	probably damaging	1.00
IGL01663:Tlr1	APN	5	64925073	missense	possibly damaging	0.48
IGL01689:Tlr1	APN	5	64925779	missense	probably damaging	0.97
IGL01749:Tlr1	APN	5	64925947	nonsense	probably null
IGL01751:Tlr1	APN	5	64925947	nonsense	probably null
IGL01769:Tlr1	APN	5	64925947	nonsense	probably null
IGL01899:Tlr1	APN	5	64927016	missense	probably damaging	0.97
IGL02197:Tlr1	APN	5	64926454	missense	probably damaging	1.00
IGL02295:Tlr1	APN	5	64925947	nonsense	probably null
IGL02308:Tlr1	APN	5	64925947	nonsense	probably null
IGL02309:Tlr1	APN	5	64925947	nonsense	probably null
IGL02311:Tlr1	APN	5	64925947	nonsense	probably null
IGL02591:Tlr1	APN	5	64926716	missense	probably damaging	1.00
IGL02739:Tlr1	APN	5	64927126	missense	probably benign	0.41
IGL03206:Tlr1	APN	5	64925057	missense	probably damaging	0.99
IGL03055:Tlr1	UTSW	5	64926596	missense	probably benign	0.05
R0315:Tlr1	UTSW	5	64926928	missense	probably damaging	0.99
R0317:Tlr1	UTSW	5	64925967	nonsense	probably null
R0511:Tlr1	UTSW	5	64926620	missense	probably damaging	0.98
R1539:Tlr1	UTSW	5	64926976	missense	probably damaging	1.00
R1552:Tlr1	UTSW	5	64926860	missense	probably damaging	1.00
R1933:Tlr1	UTSW	5	64925438	missense	possibly damaging	0.94
R1956:Tlr1	UTSW	5	64925177	missense	probably damaging	1.00
R2099:Tlr1	UTSW	5	64925068	missense	probably damaging	1.00
R2507:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2508:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2937:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R2938:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R3033:Tlr1	UTSW	5	64925569	missense	probably damaging	1.00
R4164:Tlr1	UTSW	5	64927202	missense	possibly damaging	0.47
R4226:Tlr1	UTSW	5	64925717	missense	probably damaging	0.96
R4366:Tlr1	UTSW	5	64925837	missense	probably benign	0.00
R5009:Tlr1	UTSW	5	64926224	missense	probably damaging	1.00
R5029:Tlr1	UTSW	5	64925681	missense	probably damaging	0.97
R5069:Tlr1	UTSW	5	64926400	missense	probably benign	0.01
R5186:Tlr1	UTSW	5	64925221	missense	probably damaging	1.00
R5336:Tlr1	UTSW	5	64925802	missense	probably damaging	1.00
R5500:Tlr1	UTSW	5	64927098	missense	probably benign	0.08
R5503:Tlr1	UTSW	5	64926292	missense	probably damaging	0.99
R5577:Tlr1	UTSW	5	64926085	missense	possibly damaging	0.94
R6141:Tlr1	UTSW	5	64925213	missense	possibly damaging	0.92
R6210:Tlr1	UTSW	5	64925286	missense	probably damaging	1.00
R6238:Tlr1	UTSW	5	64927129	missense	possibly damaging	0.86
R6284:Tlr1	UTSW	5	64927099	missense	possibly damaging	0.93
R6311:Tlr1	UTSW	5	64926845	missense	probably damaging	0.99
R7021:Tlr1	UTSW	5	64925713	missense	possibly damaging	0.75
R7140:Tlr1	UTSW	5	64925678	missense	probably benign	0.01
R7234:Tlr1	UTSW	5	64926724	missense	probably damaging	0.96
R7278:Tlr1	UTSW	5	64926772	missense	probably benign	0.03
R7378:Tlr1	UTSW	5	64925228	missense	not run
R7652:Tlr1	UTSW	5	64926787	nonsense	probably null
R7781:Tlr1	UTSW	5	64926736	missense	possibly damaging	0.94
R7783:Tlr1	UTSW	5	64924921	missense	probably damaging	1.00
R7851:Tlr1	UTSW	5	64924964	missense	possibly damaging	0.58
R8546:Tlr1	UTSW	5	64927031	missense	probably damaging	0.99
R8696:Tlr1	UTSW	5	64926751	missense	probably benign	0.00
R8744:Tlr1	UTSW	5	64926530	missense	possibly damaging	0.77
R9086:Tlr1	UTSW	5	64925855	missense	probably damaging	1.00
R9160:Tlr1	UTSW	5	64926310	missense	probably benign	0.00
R9199:Tlr1	UTSW	5	64926191	missense	possibly damaging	0.87
R9778:Tlr1	UTSW	5	64926028	missense	probably damaging	1.00
X0067:Tlr1	UTSW	5	64926575	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCAGTTCCCCTAGAGCTTTC -3'
(R):5'- ATGCTTACAGGCTCTGTCTTCAG -3'

Sequencing Primer
(F):5'- CTGGGTAGTCACACCTGTAAGAGTC -3'
(R):5'- TCCCAAAGTCAAGGTCCTTG -3'

Posted On

2014-06-23