Incidental Mutation 'R6152:Gpr161'
ID489320
Institutional Source Beutler Lab
Gene Symbol Gpr161
Ensembl Gene ENSMUSG00000040836
Gene NameG protein-coupled receptor 161
SynonymsLOC240888, vl
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location165295789-165326745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165310295 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 150 (V150E)
Ref Sequence ENSEMBL: ENSMUSP00000136621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]
Predicted Effect probably benign
Transcript: ENSMUST00000111450
AA Change: V133E

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: V133E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178700
AA Change: V150E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: V150E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 63 273 1.5e-7 PFAM
Pfam:7tm_1 72 352 9.2e-48 PFAM
low complexity region 491 504 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cblb T A 16: 52,141,056 C345S probably damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hmg20a A G 9: 56,481,608 D153G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Ndfip2 A G 14: 105,298,104 I275V possibly damaging Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Prpf6 A G 2: 181,621,787 R147G probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Gpr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Gpr161 APN 1 165318803 missense probably benign
IGL01090:Gpr161 APN 1 165306580 missense probably damaging 1.00
IGL01151:Gpr161 APN 1 165321509 missense probably damaging 1.00
IGL01763:Gpr161 APN 1 165317251 missense probably benign 0.09
IGL03206:Gpr161 APN 1 165321649 missense probably damaging 1.00
IGL03279:Gpr161 APN 1 165310529 missense probably damaging 1.00
IGL03378:Gpr161 APN 1 165310508 missense probably damaging 0.99
IGL03147:Gpr161 UTSW 1 165317308 missense probably benign 0.30
R0367:Gpr161 UTSW 1 165317236 splice site probably benign
R1827:Gpr161 UTSW 1 165306567 missense possibly damaging 0.94
R1970:Gpr161 UTSW 1 165306358 missense probably damaging 0.97
R1991:Gpr161 UTSW 1 165306563 missense probably damaging 0.98
R2425:Gpr161 UTSW 1 165310623 missense possibly damaging 0.83
R4805:Gpr161 UTSW 1 165306460 missense probably damaging 1.00
R5416:Gpr161 UTSW 1 165321461 missense probably benign 0.00
R5546:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5547:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5824:Gpr161 UTSW 1 165310991 missense possibly damaging 0.94
R6658:Gpr161 UTSW 1 165306567 missense possibly damaging 0.50
R6924:Gpr161 UTSW 1 165321619 missense possibly damaging 0.83
R7128:Gpr161 UTSW 1 165310457 missense possibly damaging 0.92
R7216:Gpr161 UTSW 1 165306546 missense probably benign 0.22
R7540:Gpr161 UTSW 1 165318835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGTCTATGGAGCCCAG -3'
(R):5'- AAAATGGTGTAGCCGGGTTCC -3'

Sequencing Primer
(F):5'- CTATATAGCGAGTTCCAGGGC -3'
(R):5'- TAGCCGGGTTCCTGGTGC -3'
Posted On2017-10-10