Incidental Mutation 'R3922:Pramel5'
ID306976
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Namepreferentially expressed antigen in melanoma like 5
SynonymsOTTMUSG00000010540
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144270633-144280488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144273052 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 155 (L155P)
Ref Sequence ENSEMBL: ENSMUSP00000101378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
Predicted Effect probably damaging
Transcript: ENSMUST00000035757
AA Change: L155P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: L155P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105752
AA Change: L155P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: L155P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144127
Meta Mutation Damage Score 0.5208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144271621 missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144273979 missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144271272 missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144271162 utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144273859 missense probably benign 0.01
IGL02150:Pramel5 APN 4 144273201 missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144271551 missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144273112 missense probably benign 0.25
IGL02868:Pramel5 APN 4 144271352 missense probably benign 0.03
IGL02981:Pramel5 APN 4 144272860 missense probably benign 0.01
R0532:Pramel5 UTSW 4 144272740 missense probably benign 0.03
R0646:Pramel5 UTSW 4 144271620 missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144271488 missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144273863 nonsense probably null
R2027:Pramel5 UTSW 4 144271704 missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144272936 nonsense probably null
R2439:Pramel5 UTSW 4 144273740 missense probably benign 0.01
R4470:Pramel5 UTSW 4 144271345 missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 144272755 missense probably benign 0.04
R4969:Pramel5 UTSW 4 144271617 missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144271741 missense probably benign 0.01
R5198:Pramel5 UTSW 4 144273494 intron probably benign
R5930:Pramel5 UTSW 4 144272983 missense probably benign 0.43
R5988:Pramel5 UTSW 4 144273146 missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144273105 missense probably benign 0.32
R6988:Pramel5 UTSW 4 144274007 start gained probably benign
R7116:Pramel5 UTSW 4 144273881 missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144271440 missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 144272825 missense probably damaging 1.00
X0028:Pramel5 UTSW 4 144272836 missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144273860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGTCTGCAAGGTCAGGAG -3'
(R):5'- GAACCTACAAGTGCTTGATTTGGG -3'

Sequencing Primer
(F):5'- TCTGCAAGGTCAGGAGGTCTC -3'
(R):5'- ACAAGTGCTTGATTTGGGAAATGCC -3'
Posted On2015-04-17