Incidental Mutation 'R6196:Ctsr'
ID502942
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61160531 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 266 (H266Q)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect probably benign
Transcript: ENSMUST00000021889
AA Change: H266Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: H266Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Atp6v1c2 C A 12: 17,301,186 E105* probably null Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1 G A 11: 73,395,473 A183V probably benign Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trpm7 G A 2: 126,825,639 P811S possibly damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
PIT4687001:Ctsr UTSW 13 61160532 missense possibly damaging 0.52
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6719:Ctsr UTSW 13 61160451 missense possibly damaging 0.60
R7530:Ctsr UTSW 13 61163117 missense probably damaging 1.00
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
R7963:Ctsr UTSW 13 61162462 missense probably damaging 1.00
R8251:Ctsr UTSW 13 61162778 missense probably damaging 1.00
R8431:Ctsr UTSW 13 61160490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTATGTATCCAATTGCTGACTTG -3'
(R):5'- GCACATAGACAAGTGTTTACCAAC -3'

Sequencing Primer
(F):5'- ATCCCCCTGAAATGTTAGGCAGTG -3'
(R):5'- AGACAAGTGTTTACCAACAAATAAAC -3'
Posted On2018-02-27