Mutagenetix > Incidental Mutation

Incidental Mutation 'R4195:Lman2l'

318512

Institutional Source

Beutler Lab

Gene Symbol

Lman2l

Ensembl Gene

ENSMUSG00000001143

Gene Name

lectin, mannose-binding 2-like

Synonyms

A630028F14Rik, VIP36-like

MMRRC Submission

041026-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.781) question?

Stock #

R4195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36419871-36445271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 36424941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 266 (I266M)

Ref Sequence

ENSEMBL: ENSMUSP00000117200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]

AlphaFold

P59481

Predicted Effect

probably benign
Transcript: ENSMUST00000001171

SMART Domains

Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	146	1.5e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115011
AA Change: I277M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: I277M

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	286	2e-84	PFAM
transmembrane domain	324	346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123583

SMART Domains

Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000125304
AA Change: I266M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: I266M

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	275	3.2e-88	PFAM
transmembrane domain	313	335	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134594

Predicted Effect

probably benign
Transcript: ENSMUST00000140452

SMART Domains

Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

Domain	Start	End	E-Value	Type
Pfam:C2	1	78	1.4e-5	PFAM
Blast:C2	148	209	3e-37	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000152088
AA Change: I66M

SMART Domains

Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: I66M

Domain	Start	End	E-Value	Type
Pfam:Lectin_leg-like	1	76	1.3e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179162

SMART Domains

Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

Domain	Start	End	E-Value	Type
C2	1	98	2.74e-4	SMART
C2	168	264	4.29e-6	SMART
FerI	250	323	1.59e-19	SMART
C2	325	422	1.06e-5	SMART
FerA	602	669	6.26e-18	SMART
FerB	691	764	1.38e-37	SMART
internal_repeat_1	781	836	1.77e-5	PROSPERO
internal_repeat_1	852	904	1.77e-5	PROSPERO
DysFC	913	951	1.61e-3	SMART
DysFC	981	1013	4.81e-2	SMART
C2	1078	1222	1.56e0	SMART
Pfam:C2	1248	1329	1e-1	PFAM
low complexity region	1376	1387	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
C2	1487	1586	2.21e-8	SMART
C2	1659	1851	5.32e-2	SMART
transmembrane domain	1964	1986	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000192969
AA Change: I145M

Meta Mutation Damage Score

0.1920

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Lman2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lman2l	APN	1	36438834	critical splice acceptor site	probably null
IGL02301:Lman2l	APN	1	36443543	missense	probably damaging	1.00
IGL03288:Lman2l	APN	1	36443547	missense	probably damaging	0.98
IGL03295:Lman2l	APN	1	36438811	missense	probably damaging	1.00
R0128:Lman2l	UTSW	1	36424864	nonsense	probably null
R0130:Lman2l	UTSW	1	36424864	nonsense	probably null
R0981:Lman2l	UTSW	1	36445233	start codon destroyed	unknown
R2010:Lman2l	UTSW	1	36445181	nonsense	probably null
R2039:Lman2l	UTSW	1	36428454	missense	probably damaging	1.00
R2343:Lman2l	UTSW	1	36428109	missense	possibly damaging	0.90
R4394:Lman2l	UTSW	1	36439723	missense	probably damaging	1.00
R4526:Lman2l	UTSW	1	36438763	missense	probably damaging	0.98
R5747:Lman2l	UTSW	1	36424957	missense	possibly damaging	0.90
R6156:Lman2l	UTSW	1	36438826	missense	probably damaging	1.00
R6264:Lman2l	UTSW	1	36438769	missense	probably damaging	1.00
R7013:Lman2l	UTSW	1	36443518	unclassified	probably benign
R9189:Lman2l	UTSW	1	36439690	missense	probably damaging	1.00
R9356:Lman2l	UTSW	1	36428334	missense	probably damaging	1.00
R9577:Lman2l	UTSW	1	36428409	missense	probably damaging	1.00
Z1176:Lman2l	UTSW	1	36428376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTTGTGCCTCACAGGAG -3'
(R):5'- AGCATGCTGTATTTGTGCCCC -3'

Sequencing Primer
(F):5'- TGCCTCACAGGAGCTCAGAAG -3'
(R):5'- TGTGCCCCCACTACCACG -3'

Posted On

2015-06-10