Incidental Mutation 'R4195:Lman2l'
ID 318512
Institutional Source Beutler Lab
Gene Symbol Lman2l
Ensembl Gene ENSMUSG00000001143
Gene Name lectin, mannose-binding 2-like
Synonyms A630028F14Rik, VIP36-like
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 36419871-36445271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 36424941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 266 (I266M)
Ref Sequence ENSEMBL: ENSMUSP00000117200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304] [ENSMUST00000140452] [ENSMUST00000179162]
AlphaFold P59481
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115011
AA Change: I277M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: I277M

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123583
SMART Domains Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125304
AA Change: I266M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: I266M

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134594
Predicted Effect probably benign
Transcript: ENSMUST00000140452
SMART Domains Protein: ENSMUSP00000144430
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
Pfam:C2 1 78 1.4e-5 PFAM
Blast:C2 148 209 3e-37 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000152088
AA Change: I66M
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: I66M

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192969
AA Change: I145M
Meta Mutation Damage Score 0.1920 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Lman2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lman2l APN 1 36438834 critical splice acceptor site probably null
IGL02301:Lman2l APN 1 36443543 missense probably damaging 1.00
IGL03288:Lman2l APN 1 36443547 missense probably damaging 0.98
IGL03295:Lman2l APN 1 36438811 missense probably damaging 1.00
R0128:Lman2l UTSW 1 36424864 nonsense probably null
R0130:Lman2l UTSW 1 36424864 nonsense probably null
R0981:Lman2l UTSW 1 36445233 start codon destroyed unknown
R2010:Lman2l UTSW 1 36445181 nonsense probably null
R2039:Lman2l UTSW 1 36428454 missense probably damaging 1.00
R2343:Lman2l UTSW 1 36428109 missense possibly damaging 0.90
R4394:Lman2l UTSW 1 36439723 missense probably damaging 1.00
R4526:Lman2l UTSW 1 36438763 missense probably damaging 0.98
R5747:Lman2l UTSW 1 36424957 missense possibly damaging 0.90
R6156:Lman2l UTSW 1 36438826 missense probably damaging 1.00
R6264:Lman2l UTSW 1 36438769 missense probably damaging 1.00
R7013:Lman2l UTSW 1 36443518 unclassified probably benign
R9189:Lman2l UTSW 1 36439690 missense probably damaging 1.00
R9356:Lman2l UTSW 1 36428334 missense probably damaging 1.00
Z1176:Lman2l UTSW 1 36428376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGTGCCTCACAGGAG -3'
(R):5'- AGCATGCTGTATTTGTGCCCC -3'

Sequencing Primer
(F):5'- TGCCTCACAGGAGCTCAGAAG -3'
(R):5'- TGTGCCCCCACTACCACG -3'
Posted On 2015-06-10