Incidental Mutation 'R6272:Apbb2'
ID507389
Institutional Source Beutler Lab
Gene Symbol Apbb2
Ensembl Gene ENSMUSG00000029207
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 2
SynonymsTR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location66298703-66618784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66311072 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 561 (T561A)
Ref Sequence ENSEMBL: ENSMUSP00000124807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087256] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160063] [ENSMUST00000160870] [ENSMUST00000162349] [ENSMUST00000162366]
Predicted Effect probably benign
Transcript: ENSMUST00000087256
AA Change: T583A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: T583A

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159512
AA Change: T561A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: T561A

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159786
AA Change: T560A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: T560A

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160063
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160775
Predicted Effect probably benign
Transcript: ENSMUST00000160870
AA Change: T581A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: T581A

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161771
Predicted Effect probably benign
Transcript: ENSMUST00000162349
AA Change: T583A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: T583A

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162366
AA Change: T559A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: T559A

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201776
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Apbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
bund UTSW 5 66400255 missense probably damaging 1.00
Dionysis UTSW 5 66452250 missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0564:Apbb2 UTSW 5 66452250 missense probably damaging 0.99
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6280:Apbb2 UTSW 5 66364982 missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
R7091:Apbb2 UTSW 5 66313334 missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66451603 missense probably damaging 1.00
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGGCATGAATCCAGAC -3'
(R):5'- CTTCCAAAAGCATTTCGCCAG -3'

Sequencing Primer
(F):5'- CCAGACATGGTGAGGAATGGTAC -3'
(R):5'- GTCTAGACTGACAGGACCCTC -3'
Posted On2018-03-15