Mutagenetix > Incidental Mutation

Incidental Mutation 'R6272:Matn2'

507420

Institutional Source

Beutler Lab

Gene Symbol

Matn2

Ensembl Gene

ENSMUSG00000022324

Gene Name

matrilin 2

Synonyms

Crtm2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6272 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34306677-34436273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34355607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 33 (Q33L)

Ref Sequence

ENSEMBL: ENSMUSP00000154567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000179647] [ENSMUST00000227759] [ENSMUST00000227772] [ENSMUST00000228570]

AlphaFold

O08746

Predicted Effect

probably benign
Transcript: ENSMUST00000022947
AA Change: C253S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: C253S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	889	935	4.78e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163455
AA Change: C253S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: C253S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	908	955	7.77e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179647
AA Change: Q33L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000227759
AA Change: C253S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227772
AA Change: Q33L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000228570
AA Change: C253S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Adgrg3	A	G	8: 95,036,261	I189V	noncoding transcript	Het
Ampd1	A	G	3: 103,085,383	K147R	possibly damaging	Het
Apbb2	T	C	5: 66,311,072	T561A	probably damaging	Het
Arfgef3	A	T	10: 18,646,963	D438E	probably benign	Het
Atxn1	T	A	13: 45,567,762	Q219L	possibly damaging	Het
AW551984	A	T	9: 39,598,037	D269E	probably benign	Het
Cryab	A	G	9: 50,754,525	K72R	possibly damaging	Het
Dbn1	G	A	13: 55,475,104	A522V	probably benign	Het
Dip2a	A	T	10: 76,286,407	*158R	probably null	Het
Edrf1	C	T	7: 133,637,808		probably benign	Het
Ern2	A	T	7: 122,176,646	D408E	probably benign	Het
F830016B08Rik	T	C	18: 60,300,078	S78P	probably damaging	Het
Fah	C	A	7: 84,595,545	G137C	probably damaging	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Foxd3	A	G	4: 99,656,740	D39G	probably damaging	Het
Gm3854	C	T	7: 6,353,845	P219L	probably damaging	Het
Gprin3	G	A	6: 59,353,331	Q664*	probably null	Het
H2-Ob	T	C	17: 34,242,644	I119T	probably benign	Het
Hist1h3e	A	T	13: 23,562,226	V47E	probably damaging	Het
Hmgcll1	G	A	9: 76,130,345	G174R	probably damaging	Het
Kbtbd11	T	A	8: 15,029,118	C572*	probably null	Het
Kynu	A	T	2: 43,634,989	N315Y	probably benign	Het
Map1lc3b	G	A	8: 121,596,690	E100K	probably benign	Het
Mettl8	T	C	2: 70,976,075		probably null	Het
Neto1	A	T	18: 86,494,815	N312Y	probably damaging	Het
Nhsl1	A	G	10: 18,524,505	D493G	probably benign	Het
Nup210l	A	G	3: 90,170,024	E889G	possibly damaging	Het
Olfr1153	G	A	2: 87,896,657	V153I	probably benign	Het
Olfr1383	C	A	11: 49,524,126	S134R	possibly damaging	Het
Olfr1402	A	G	3: 97,410,891	F97L	probably benign	Het
Olfr209	A	C	16: 59,361,585	M211R	possibly damaging	Het
Olfr296-ps1	A	G	7: 86,561,873	Y47C	unknown	Het
Olfr420	C	T	1: 174,159,175	T134I	probably benign	Het
Olfr967	A	T	9: 39,750,520	M45L	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Phc2	A	G	4: 128,709,647	Y190C	probably damaging	Het
Platr25	T	C	13: 62,672,997	T347A	possibly damaging	Het
Plec	T	C	15: 76,174,853	E3655G	probably damaging	Het
Plekhg3	A	T	12: 76,576,845	Q954L	probably benign	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prdm4	G	A	10: 85,907,830	T187I	possibly damaging	Het
Prg4	T	C	1: 150,454,766		probably benign	Het
Prpf18	G	A	2: 4,633,447	R312W	probably damaging	Het
Rnf213	T	A	11: 119,414,548	V535D	probably damaging	Het
Rtcb	A	T	10: 85,955,774	N39K	probably damaging	Het
Slc4a3	G	A	1: 75,554,697		probably null	Het
Szt2	A	C	4: 118,374,290		probably benign	Het
Tfap2e	A	T	4: 126,721,864	V259D	probably damaging	Het
Trav19	A	G	14: 53,845,798	D110G	probably damaging	Het
Ttc17	A	C	2: 94,358,755	C749W	probably damaging	Het
Ttc8	A	G	12: 98,982,494	K490E	possibly damaging	Het
Ube4b	A	G	4: 149,387,133	S99P	probably damaging	Het
Ubqln3	C	T	7: 104,142,178	R235H	probably damaging	Het
Vmn2r61	A	T	7: 42,299,818	D554V	probably damaging	Het
Vmn2r70	A	T	7: 85,558,986	V761E	probably damaging	Het
Vmn2r97	T	C	17: 18,947,599	I705T	possibly damaging	Het
Wwox	G	A	8: 114,488,952	C155Y	probably damaging	Het
Zfp451	T	C	1: 33,803,244		probably benign	Het

Other mutations in Matn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Matn2	APN	15	34428470	missense	probably damaging	1.00
IGL00392:Matn2	APN	15	34402856	missense	probably benign	0.00
IGL01475:Matn2	APN	15	34316525	missense	possibly damaging	0.94
IGL02223:Matn2	APN	15	34423718	missense	probably benign	0.00
IGL02252:Matn2	APN	15	34316590	missense	probably damaging	0.98
IGL02288:Matn2	APN	15	34422386	missense	probably damaging	1.00
IGL02738:Matn2	APN	15	34388739	missense	probably benign	0.07
IGL02927:Matn2	APN	15	34355655	missense	probably damaging	1.00
IGL03331:Matn2	APN	15	34345357	missense	probably damaging	1.00
Engorged	UTSW	15	34426234	missense	probably damaging	1.00
PIT4260001:Matn2	UTSW	15	34428731	missense	possibly damaging	0.78
R0124:Matn2	UTSW	15	34426151	splice site	probably benign
R0422:Matn2	UTSW	15	34435771	splice site	probably null
R0449:Matn2	UTSW	15	34428541	missense	probably damaging	1.00
R0606:Matn2	UTSW	15	34345150	missense	probably damaging	1.00
R0655:Matn2	UTSW	15	34345200	missense	probably benign	0.03
R0885:Matn2	UTSW	15	34316605	missense	possibly damaging	0.67
R1384:Matn2	UTSW	15	34409810	missense	probably benign	0.00
R1603:Matn2	UTSW	15	34388768	missense	probably damaging	1.00
R1667:Matn2	UTSW	15	34378732	missense	probably damaging	0.99
R1720:Matn2	UTSW	15	34345274	nonsense	probably null
R1772:Matn2	UTSW	15	34428785	missense	probably damaging	0.99
R2037:Matn2	UTSW	15	34433117	missense	probably benign	0.00
R2107:Matn2	UTSW	15	34423759	missense	probably damaging	1.00
R2240:Matn2	UTSW	15	34433063	missense	probably damaging	1.00
R3933:Matn2	UTSW	15	34345420	splice site	probably null
R3963:Matn2	UTSW	15	34388791	nonsense	probably null
R4648:Matn2	UTSW	15	34428533	missense	probably damaging	1.00
R4695:Matn2	UTSW	15	34402925	missense	probably damaging	1.00
R4817:Matn2	UTSW	15	34423799	missense	probably damaging	1.00
R4935:Matn2	UTSW	15	34428685	missense	probably damaging	1.00
R5105:Matn2	UTSW	15	34355668	missense	possibly damaging	0.95
R5177:Matn2	UTSW	15	34433514	missense	possibly damaging	0.58
R5717:Matn2	UTSW	15	34399091	nonsense	probably null
R5760:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R5776:Matn2	UTSW	15	34431619	missense	probably damaging	1.00
R5842:Matn2	UTSW	15	34399056	missense	probably damaging	0.99
R5917:Matn2	UTSW	15	34409766	nonsense	probably null
R5964:Matn2	UTSW	15	34410165	missense	probably damaging	1.00
R6265:Matn2	UTSW	15	34399155	missense	probably damaging	1.00
R6332:Matn2	UTSW	15	34423755	missense	probably benign	0.00
R6457:Matn2	UTSW	15	34426234	missense	probably damaging	1.00
R7351:Matn2	UTSW	15	34345336	missense	probably damaging	0.97
R7660:Matn2	UTSW	15	34402946	missense	probably benign	0.00
R7660:Matn2	UTSW	15	34423728	nonsense	probably null
R7775:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R7778:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R8007:Matn2	UTSW	15	34426169	missense	probably benign	0.01
R8059:Matn2	UTSW	15	34345335	missense	probably damaging	1.00
R8174:Matn2	UTSW	15	34422409	missense	probably benign	0.30
R8331:Matn2	UTSW	15	34428681	missense	probably damaging	1.00
R8354:Matn2	UTSW	15	34378697	missense	probably damaging	0.98
R8377:Matn2	UTSW	15	34345365	missense	probably damaging	1.00
R8393:Matn2	UTSW	15	34355602	missense	possibly damaging	0.92
R8532:Matn2	UTSW	15	34316553	missense	probably benign	0.42
R8555:Matn2	UTSW	15	34423805	missense	probably benign	0.03
R8756:Matn2	UTSW	15	34423730	missense	possibly damaging	0.94
R8973:Matn2	UTSW	15	34433050	missense	probably benign	0.01
R9198:Matn2	UTSW	15	34423778	missense	probably damaging	0.99
R9220:Matn2	UTSW	15	34410179	missense	possibly damaging	0.58
R9478:Matn2	UTSW	15	34345096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACGTCAGATTCTATCGCTTTGG -3'
(R):5'- TGCACAGTTGTCAAGTTGGTTTAAC -3'

Sequencing Primer
(F):5'- CAGATTCTATCGCTTTGGGTTCAAGC -3'
(R):5'- TGATCCGTGCTGAGAATG -3'

Posted On

2018-03-15