Incidental Mutation 'R8201:Apbb2'
ID635670
Institutional Source Beutler Lab
Gene Symbol Apbb2
Ensembl Gene ENSMUSG00000029207
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 2
SynonymsTR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location66298703-66618784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66309115 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 609 (N609S)
Ref Sequence ENSEMBL: ENSMUSP00000125116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087256] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160063] [ENSMUST00000160870] [ENSMUST00000162349] [ENSMUST00000162366]
Predicted Effect probably benign
Transcript: ENSMUST00000087256
AA Change: N633S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: N633S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159512
AA Change: N611S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: N611S

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159786
AA Change: N610S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: N610S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160063
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160870
AA Change: N631S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: N631S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162349
AA Change: N633S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: N633S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162366
AA Change: N609S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: N609S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Apbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
bund UTSW 5 66400255 missense probably damaging 1.00
Dionysis UTSW 5 66452250 missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0564:Apbb2 UTSW 5 66452250 missense probably damaging 0.99
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66311072 missense probably damaging 0.97
R6280:Apbb2 UTSW 5 66364982 missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
R7091:Apbb2 UTSW 5 66313334 missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66451603 missense probably damaging 1.00
R7984:Apbb2 UTSW 5 66307692 missense probably damaging 1.00
R8026:Apbb2 UTSW 5 66451644 missense probably benign 0.00
R8309:Apbb2 UTSW 5 66362836 missense probably benign 0.01
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAAAGCCTCGAGTCTTC -3'
(R):5'- TCTTCTGAGCAAACGAGAATAGAG -3'

Sequencing Primer
(F):5'- GACAAAGCCTCGAGTCTTCTTTAAC -3'
(R):5'- TGATAAGGTGGCCCGGTAC -3'
Posted On2020-07-13