Mutagenetix > Incidental Mutations

Incidental Mutation 'R6281:Slc17a3'

507970

Institutional Source

Beutler Lab

Gene Symbol

Slc17a3

Ensembl Gene

ENSMUSG00000036083

Gene Name

solute carrier family 17 (sodium phosphate), member 3

Synonyms

Npt4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23839434-23860716 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23856799 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 336 (I336N)

Ref Sequence

ENSEMBL: ENSMUSP00000089290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]

Predicted Effect

probably benign
Transcript: ENSMUST00000039721
AA Change: I414N

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: I414N

Domain	Start	End	E-Value	Type
Pfam:MFS_1	45	377	3.3e-46	PFAM
transmembrane domain	393	415	N/A	INTRINSIC
transmembrane domain	430	452	N/A	INTRINSIC
transmembrane domain	459	481	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091698
AA Change: I336N

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: I336N

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
Pfam:MFS_1	95	293	2.8e-25	PFAM
transmembrane domain	310	332	N/A	INTRINSIC
transmembrane domain	352	369	N/A	INTRINSIC
transmembrane domain	379	398	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110422
AA Change: I378N

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: I378N

Domain	Start	End	E-Value	Type
Pfam:MFS_1	39	425	6.7e-47	PFAM
transmembrane domain	453	475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166467
AA Change: I414N

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: I414N

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	338	2.3e-46	PFAM
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Meta Mutation Damage Score

0.1808

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	C	A	8: 121,531,881	C166F	probably damaging	Het
Aida	C	T	1: 183,322,290	A237V	probably damaging	Het
Ankib1	T	C	5: 3,701,965	T692A	possibly damaging	Het
As3mt	T	C	19: 46,724,923	V303A	possibly damaging	Het
Bhlhe40	T	A	6: 108,664,462		probably null	Het
Bhmt2	G	A	13: 93,663,160	P256L	probably damaging	Het
Bpifb1	T	C	2: 154,206,465	I140T	probably damaging	Het
Cat	A	T	2: 103,471,769	H194Q	probably damaging	Het
Cbfa2t3	C	A	8: 122,633,409	R466L	probably damaging	Het
Fancm	T	C	12: 65,088,270	V279A	probably damaging	Het
Gabra2	T	C	5: 71,034,762	T75A	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm3512	T	A	14: 7,159,254	D7V	possibly damaging	Het
Gpr15	A	G	16: 58,718,594	F44S	probably damaging	Het
Ighv1-72	C	A	12: 115,758,403	C5F	probably benign	Het
Lilra6	A	G	7: 3,911,973	L474P	probably damaging	Het
Mboat2	T	C	12: 24,957,679	V297A	probably benign	Het
Muc2	C	G	7: 141,752,403	C276W	probably damaging	Het
Ncor1	T	C	11: 62,373,545	S141G	possibly damaging	Het
Olfr1283	T	C	2: 111,369,549	*306R	probably null	Het
Olfr508	T	G	7: 108,630,402	S137A	probably benign	Het
Pax5	T	G	4: 44,691,955	E97A	probably benign	Het
Pcdhga11	A	T	18: 37,757,373	D478V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Phf21b	G	T	15: 84,854,745	D38E	probably benign	Het
Ptcd1	T	C	5: 145,165,071	K146R	probably benign	Het
Rad23a	A	T	8: 84,838,110	M166K	probably damaging	Het
Rfc4	A	T	16: 23,118,066		probably null	Het
Slc2a12	T	A	10: 22,665,320	M358K	probably damaging	Het
Stk31	T	G	6: 49,469,180	M939R	possibly damaging	Het
Tecrl	T	A	5: 83,294,606	T167S	probably damaging	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Ttn	C	T	2: 76,941,828	V2577M	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vezt	G	A	10: 93,973,946	R578C	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vwa3b	T	A	1: 37,123,982	L562Q	probably damaging	Het
Zfyve27	T	A	19: 42,182,755	N127K	probably damaging	Het
Znfx1	A	G	2: 167,055,885	F373S	probably damaging	Het
Zswim8	G	A	14: 20,714,640	V693I	probably benign	Het

Other mutations in Slc17a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Slc17a3	APN	13	23856481	missense	probably benign	0.20
IGL02569:Slc17a3	APN	13	23846302	missense	probably damaging	1.00
IGL02628:Slc17a3	APN	13	23842451	start codon destroyed	probably null	1.00
IGL02745:Slc17a3	APN	13	23842486	missense	probably benign	0.01
IGL03001:Slc17a3	APN	13	23856784	missense	probably damaging	1.00
IGL03143:Slc17a3	APN	13	23855979	splice site	probably null
IGL03144:Slc17a3	APN	13	23846440	missense	probably benign	0.00
R0052:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0054:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0152:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0153:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0233:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0234:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0257:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0294:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0295:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0318:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0319:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0352:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0462:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0610:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0627:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0652:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0765:Slc17a3	UTSW	13	23846896	nonsense	probably null
R1529:Slc17a3	UTSW	13	23845445	missense	probably damaging	1.00
R1532:Slc17a3	UTSW	13	23856500	missense	probably damaging	1.00
R1569:Slc17a3	UTSW	13	23855608	missense	probably benign	0.09
R1640:Slc17a3	UTSW	13	23852357	nonsense	probably null
R1643:Slc17a3	UTSW	13	23857198	splice site	probably benign
R1715:Slc17a3	UTSW	13	23856741	missense	probably benign	0.19
R2407:Slc17a3	UTSW	13	23852435	critical splice donor site	probably null
R2512:Slc17a3	UTSW	13	23846247	missense	probably benign	0.13
R3923:Slc17a3	UTSW	13	23858054	missense	possibly damaging	0.89
R4449:Slc17a3	UTSW	13	23856732	missense	probably damaging	0.99
R5166:Slc17a3	UTSW	13	23842542	critical splice donor site	probably null
R5748:Slc17a3	UTSW	13	23856466	missense	probably damaging	1.00
R5989:Slc17a3	UTSW	13	23842428	start gained	probably benign
R6811:Slc17a3	UTSW	13	23855941	missense	possibly damaging	0.61
R7283:Slc17a3	UTSW	13	23855848	missense
R7341:Slc17a3	UTSW	13	23846884	nonsense	probably null
R7467:Slc17a3	UTSW	13	23846967	critical splice donor site	probably null
R7485:Slc17a3	UTSW	13	23855849	missense
R8065:Slc17a3	UTSW	13	23858087	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTGCATTGCATGGTGTAAGC -3'
(R):5'- ACCATGCATATTCAATGGGAAGC -3'

Sequencing Primer
(F):5'- GCATGGTGTAAGCATTTAACAGTC -3'
(R):5'- GCGATTTAACAAGTGCATATTTCACC -3'

Posted On

2018-03-15