Mutagenetix > Incidental Mutation

Incidental Mutation 'R6281:Vmn2r111'

507977

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

044451-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R6281 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22766922-22792254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22778032 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	C	A	8: 122,258,620 (GRCm39)	C166F	probably damaging	Het
Aida	C	T	1: 183,103,145 (GRCm39)	A237V	probably damaging	Het
Ankib1	T	C	5: 3,751,965 (GRCm39)	T692A	possibly damaging	Het
As3mt	T	C	19: 46,713,362 (GRCm39)	V303A	possibly damaging	Het
Bhlhe40	T	A	6: 108,641,423 (GRCm39)		probably null	Het
Bhmt2	G	A	13: 93,799,668 (GRCm39)	P256L	probably damaging	Het
Bpifb1	T	C	2: 154,048,385 (GRCm39)	I140T	probably damaging	Het
Cat	A	T	2: 103,302,114 (GRCm39)	H194Q	probably damaging	Het
Cbfa2t3	C	A	8: 123,360,148 (GRCm39)	R466L	probably damaging	Het
Fancm	T	C	12: 65,135,044 (GRCm39)	V279A	probably damaging	Het
Gabra2	T	C	5: 71,192,105 (GRCm39)	T75A	probably damaging	Het
Gm11595	G	A	11: 99,663,381 (GRCm39)	R100C	unknown	Het
Gm3512	T	A	14: 7,159,254 (GRCm38)	D7V	possibly damaging	Het
Gpr15	A	G	16: 58,538,957 (GRCm39)	F44S	probably damaging	Het
Ighv1-72	C	A	12: 115,722,023 (GRCm39)	C5F	probably benign	Het
Lilra6	A	G	7: 3,914,972 (GRCm39)	L474P	probably damaging	Het
Mboat2	T	C	12: 25,007,678 (GRCm39)	V297A	probably benign	Het
Muc2	C	G	7: 141,306,140 (GRCm39)	C276W	probably damaging	Het
Ncor1	T	C	11: 62,264,371 (GRCm39)	S141G	possibly damaging	Het
Or4k77	T	C	2: 111,199,894 (GRCm39)	*306R	probably null	Het
Or5p80	T	G	7: 108,229,609 (GRCm39)	S137A	probably benign	Het
Pax5	T	G	4: 44,691,955 (GRCm39)	E97A	probably benign	Het
Pcdhga11	A	T	18: 37,890,426 (GRCm39)	D478V	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449 (GRCm39)		probably benign	Het
Phf21b	G	T	15: 84,738,946 (GRCm39)	D38E	probably benign	Het
Ptcd1	T	C	5: 145,101,881 (GRCm39)	K146R	probably benign	Het
Rad23a	A	T	8: 85,564,739 (GRCm39)	M166K	probably damaging	Het
Rfc4	A	T	16: 22,936,816 (GRCm39)		probably null	Het
Slc17a3	T	A	13: 24,040,782 (GRCm39)	I336N	probably benign	Het
Slc2a12	T	A	10: 22,541,219 (GRCm39)	M358K	probably damaging	Het
Stk31	T	G	6: 49,446,114 (GRCm39)	M939R	possibly damaging	Het
Tecrl	T	A	5: 83,442,453 (GRCm39)	T167S	probably damaging	Het
Tfap2d	G	C	1: 19,174,702 (GRCm39)	G52R	probably benign	Het
Ttn	C	T	2: 76,772,172 (GRCm39)	V2577M	probably damaging	Het
Uox	C	T	3: 146,330,332 (GRCm39)	R163*	probably null	Het
Vezt	G	A	10: 93,809,808 (GRCm39)	R578C	probably benign	Het
Vwa3b	T	A	1: 37,163,063 (GRCm39)	L562Q	probably damaging	Het
Zfyve27	T	A	19: 42,171,194 (GRCm39)	N127K	probably damaging	Het
Znfx1	A	G	2: 166,897,805 (GRCm39)	F373S	probably damaging	Het
Zswim8	G	A	14: 20,764,708 (GRCm39)	V693I	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22,767,734 (GRCm39)	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22,787,965 (GRCm39)	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22,787,997 (GRCm39)	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22,790,966 (GRCm39)	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22,767,718 (GRCm39)	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22,767,553 (GRCm39)	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22,790,373 (GRCm39)	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22,788,054 (GRCm39)	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22,767,265 (GRCm39)	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22,789,754 (GRCm39)	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22,787,837 (GRCm39)	missense	probably benign
IGL02519:Vmn2r111	APN	17	22,767,320 (GRCm39)	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22,790,031 (GRCm39)	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22,792,205 (GRCm39)	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22,778,023 (GRCm39)	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22,789,839 (GRCm39)	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22,766,990 (GRCm39)	missense	probably benign
R0064:Vmn2r111	UTSW	17	22,791,053 (GRCm39)	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22,792,102 (GRCm39)	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22,790,097 (GRCm39)	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22,790,380 (GRCm39)	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22,767,041 (GRCm39)	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22,767,062 (GRCm39)	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22,767,395 (GRCm39)	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22,778,043 (GRCm39)	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22,792,085 (GRCm39)	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22,778,151 (GRCm39)	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22,790,142 (GRCm39)	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22,790,301 (GRCm39)	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22,778,096 (GRCm39)	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22,792,159 (GRCm39)	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22,767,637 (GRCm39)	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22,767,022 (GRCm39)	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22,790,124 (GRCm39)	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22,790,001 (GRCm39)	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22,767,083 (GRCm39)	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22,792,252 (GRCm39)	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22,767,470 (GRCm39)	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22,767,238 (GRCm39)	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6149:Vmn2r111	UTSW	17	22,767,796 (GRCm39)	missense	probably benign	0.00
R6207:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22,792,070 (GRCm39)	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22,790,889 (GRCm39)	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22,767,583 (GRCm39)	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22,767,165 (GRCm39)	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22,767,695 (GRCm39)	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22,790,067 (GRCm39)	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22,767,380 (GRCm39)	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22,789,714 (GRCm39)	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22,792,083 (GRCm39)	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22,790,469 (GRCm39)	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22,792,073 (GRCm39)	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22,767,562 (GRCm39)	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22,790,274 (GRCm39)	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22,778,024 (GRCm39)	missense	probably damaging	1.00
R8540:Vmn2r111	UTSW	17	22,778,023 (GRCm39)	critical splice donor site	probably null
R8557:Vmn2r111	UTSW	17	22,790,910 (GRCm39)	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22,792,194 (GRCm39)	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22,767,239 (GRCm39)	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22,767,011 (GRCm39)	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22,790,822 (GRCm39)	missense	probably benign
R9374:Vmn2r111	UTSW	17	22,787,859 (GRCm39)	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22,778,132 (GRCm39)	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22,767,676 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2018-03-15