Incidental Mutation 'R6309:Il11ra1'
ID509722
Institutional Source Beutler Lab
Gene Symbol Il11ra1
Ensembl Gene ENSMUSG00000073889
Gene Nameinterleukin 11 receptor, alpha chain 1
SynonymsIl11ra, Il-11ra, NR1, Il-11ra-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R6309 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41699989-41769474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41765279 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 151 (K151E)
Ref Sequence ENSEMBL: ENSMUSP00000103677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074387] [ENSMUST00000098132] [ENSMUST00000108033] [ENSMUST00000108035] [ENSMUST00000108036] [ENSMUST00000108037] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042] [ENSMUST00000131349] [ENSMUST00000155322] [ENSMUST00000151142]
Predicted Effect probably benign
Transcript: ENSMUST00000074387
SMART Domains Protein: ENSMUSP00000073990
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 31 97 5.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098132
AA Change: K151E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889
AA Change: K151E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108033
SMART Domains Protein: ENSMUSP00000103668
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 96 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108035
SMART Domains Protein: ENSMUSP00000103670
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 38 104 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108036
SMART Domains Protein: ENSMUSP00000103671
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108037
SMART Domains Protein: ENSMUSP00000103672
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108040
AA Change: K151E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889
AA Change: K151E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108041
AA Change: K151E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889
AA Change: K151E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108042
AA Change: K151E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889
AA Change: K151E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140894
Predicted Effect probably benign
Transcript: ENSMUST00000155322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155538
Predicted Effect probably benign
Transcript: ENSMUST00000151142
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Female homozygotes for targeted null mutations are infertile due to defective decidua formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Sh3tc2 T C 18: 61,968,010 V58A probably damaging Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Il11ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Il11ra1 APN 4 41768552 missense possibly damaging 0.73
R0013:Il11ra1 UTSW 4 41765060 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0365:Il11ra1 UTSW 4 41767527 missense probably damaging 1.00
R0399:Il11ra1 UTSW 4 41766185 missense probably benign 0.03
R1585:Il11ra1 UTSW 4 41768207 missense probably damaging 0.98
R1591:Il11ra1 UTSW 4 41766200 missense probably damaging 1.00
R2424:Il11ra1 UTSW 4 41768222 missense probably damaging 1.00
R3037:Il11ra1 UTSW 4 41765074 missense possibly damaging 0.94
R4393:Il11ra1 UTSW 4 41768577 critical splice donor site probably null
R4770:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R4798:Il11ra1 UTSW 4 41766096 unclassified probably benign
R5256:Il11ra1 UTSW 4 41767932 unclassified probably benign
R6005:Il11ra1 UTSW 4 41763887 critical splice donor site probably null
R6499:Il11ra1 UTSW 4 41765412 missense probably benign 0.04
R6833:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R6834:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R7015:Il11ra1 UTSW 4 41765421 missense probably benign 0.06
R7122:Il11ra1 UTSW 4 41766189 missense probably damaging 0.99
R7275:Il11ra1 UTSW 4 41765109 missense probably damaging 1.00
R7710:Il11ra1 UTSW 4 41764846 missense probably benign
R8116:Il11ra1 UTSW 4 41766251 missense probably benign 0.27
R8711:Il11ra1 UTSW 4 41767539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTTACTTCCTACAGGTATG -3'
(R):5'- GTTCACCTCGGTCACATTGATC -3'

Sequencing Primer
(F):5'- ACCTTACTTCCTACAGGTATGTGTGG -3'
(R):5'- CGGTCACATTGATCCGGTAC -3'
Posted On2018-04-02