Incidental Mutation 'R6309:Sh3tc2'
ID509750
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6309 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61968010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably damaging
Transcript: ENSMUST00000051720
AA Change: V58A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: V58A

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,969,393 probably null Het
Ak4 T C 4: 101,463,662 Y223H probably benign Het
Armc4 A G 18: 7,214,617 V728A probably benign Het
Cerk T C 15: 86,156,668 probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Col18a1 A G 10: 77,112,742 probably benign Het
Cpeb3 T G 19: 37,044,689 I569L possibly damaging Het
Dis3 A T 14: 99,085,922 N569K probably benign Het
Erich5 T C 15: 34,471,456 L277P probably benign Het
Fam171b T C 2: 83,860,460 S256P probably damaging Het
Glis3 A G 19: 28,317,361 V679A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm8212 A G 14: 44,201,179 probably benign Het
Grin2b T A 6: 135,733,027 T1174S probably benign Het
Hipk2 T C 6: 38,698,511 Y1045C probably damaging Het
Hsf2 C T 10: 57,486,580 probably benign Het
Ighv1-4 G T 12: 114,487,395 A31E probably benign Het
Il11ra1 A G 4: 41,765,279 K151E possibly damaging Het
Inpp4b T A 8: 82,041,917 M685K probably damaging Het
Itga4 T A 2: 79,279,085 D209E probably damaging Het
L1td1 T C 4: 98,737,091 S508P probably damaging Het
Lrrn3 G A 12: 41,453,206 R371C probably damaging Het
Nbeal1 A G 1: 60,238,719 T755A probably benign Het
Olfr129 T A 17: 38,055,152 Y138F probably damaging Het
Olfr134 T C 17: 38,175,519 V145A probably benign Het
Phf24 A G 4: 42,933,960 D14G probably damaging Het
Prkd1 A T 12: 50,394,660 C314* probably null Het
Rnf187 A T 11: 58,937,160 S155T possibly damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Scn10a A G 9: 119,624,115 I1237T possibly damaging Het
Sec16a T C 2: 26,438,571 N1144S probably benign Het
Slc37a3 T C 6: 39,357,460 *84W probably null Het
Trpm2 T A 10: 77,938,368 I466F probably damaging Het
Vmn2r108 T A 17: 20,471,398 I288F probably damaging Het
Vmn2r67 T C 7: 85,151,916 T271A probably benign Het
Vsig10l A G 7: 43,470,973 probably null Het
Wdr95 A G 5: 149,580,803 probably null Het
Zfp960 T C 17: 17,088,377 I451T probably benign Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGTAACCACTGTGCACCTC -3'
(R):5'- GGACCTACTTTGTTCCAGGC -3'

Sequencing Primer
(F):5'- ACTGTGCACCTCCTCTGAG -3'
(R):5'- GTTCCAGGCACAGTTCTTGC -3'
Posted On2018-04-02