Incidental Mutation 'R6354:Wdr66'
ID512957
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6354 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123302755 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1125 (T1125I)
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069311] [ENSMUST00000121964] [ENSMUST00000163092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069311
AA Change: T151I

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069782
Gene: ENSMUSG00000029442
AA Change: T151I

DomainStartEndE-ValueType
Blast:WD40 54 95 3e-24 BLAST
SCOP:d1exra_ 157 267 3e-4 SMART
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121964
AA Change: T1125I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: T1125I

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143629
Predicted Effect probably benign
Transcript: ENSMUST00000150155
Predicted Effect probably benign
Transcript: ENSMUST00000163092
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Meta Mutation Damage Score 0.1949 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Odf3 A G 7: 140,850,614 probably null Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Olfr683 G A 7: 105,143,708 T195I probably benign Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Sgsm1 T G 5: 113,282,656 T288P probably damaging Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Trak1 A T 9: 121,451,726 T384S probably null Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vmn2r72 A G 7: 85,750,539 probably null Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7925:Wdr66 UTSW 5 123254424 missense unknown
R7981:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCAAACCTTGGGGTCAAC -3'
(R):5'- TATTTCCAGGCTGGCTCCAG -3'

Sequencing Primer
(F):5'- CACTGAGCTCAGAATGAACTTTTTAG -3'
(R):5'- GCTGGCTCCAGAGACTCTTC -3'
Posted On2018-04-27