Incidental Mutation 'R6417:Slc16a12'
ID518135
Institutional Source Beutler Lab
Gene Symbol Slc16a12
Ensembl Gene ENSMUSG00000009378
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34668403-34747289 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 34672697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000009522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009522] [ENSMUST00000009522]
Predicted Effect probably null
Transcript: ENSMUST00000009522
SMART Domains Protein: ENSMUSP00000009522
Gene: ENSMUSG00000009378

DomainStartEndE-ValueType
Pfam:MFS_1 25 232 5.6e-23 PFAM
Pfam:MFS_1 253 465 1.5e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000009522
SMART Domains Protein: ENSMUSP00000009522
Gene: ENSMUSG00000009378

DomainStartEndE-ValueType
Pfam:MFS_1 25 232 5.6e-23 PFAM
Pfam:MFS_1 253 465 1.5e-16 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane transporter that likely plays a role in monocarboxylic acid transport. A mutation in this gene has been associated with juvenile cataracts with microcornea and renal glucosuria. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Zswim3 G A 2: 164,820,733 V378M probably damaging Het
Other mutations in Slc16a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc16a12 APN 19 34672684 missense possibly damaging 0.57
IGL01728:Slc16a12 APN 19 34690671 missense possibly damaging 0.71
PIT1430001:Slc16a12 UTSW 19 34677359 missense possibly damaging 0.50
R0017:Slc16a12 UTSW 19 34672698 splice site probably benign
R0122:Slc16a12 UTSW 19 34674864 missense probably benign 0.03
R0140:Slc16a12 UTSW 19 34672704 splice site probably benign
R1669:Slc16a12 UTSW 19 34680381 missense probably benign 0.33
R1824:Slc16a12 UTSW 19 34670878 missense possibly damaging 0.89
R4033:Slc16a12 UTSW 19 34675167 missense probably damaging 1.00
R4669:Slc16a12 UTSW 19 34672565 missense probably damaging 1.00
R4703:Slc16a12 UTSW 19 34674891 missense possibly damaging 0.94
R4832:Slc16a12 UTSW 19 34680380 missense possibly damaging 0.84
R4937:Slc16a12 UTSW 19 34675243 missense probably damaging 1.00
R4997:Slc16a12 UTSW 19 34674958 missense probably benign 0.00
R5613:Slc16a12 UTSW 19 34674958 missense probably benign 0.43
R5725:Slc16a12 UTSW 19 34674827 missense probably damaging 1.00
R6139:Slc16a12 UTSW 19 34670895 critical splice acceptor site probably null
R6420:Slc16a12 UTSW 19 34672697 critical splice acceptor site probably null
R6947:Slc16a12 UTSW 19 34672607 missense probably benign 0.03
R7694:Slc16a12 UTSW 19 34670635 missense probably damaging 1.00
R7819:Slc16a12 UTSW 19 34675179 missense probably damaging 1.00
R7860:Slc16a12 UTSW 19 34675330 missense probably benign 0.00
R7943:Slc16a12 UTSW 19 34675330 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTATCTCTGCAGTCACGACC -3'
(R):5'- AACACCATACTATGCTTCCTGC -3'

Sequencing Primer
(F):5'- TCACGACCGGGATCAAGGTAAC -3'
(R):5'- AATATGGCCTCCATGGTAGC -3'
Posted On2018-05-24