Incidental Mutation 'R6417:Zswim3'
ID518110
Institutional Source Beutler Lab
Gene Symbol Zswim3
Ensembl Gene ENSMUSG00000045822
Gene Namezinc finger SWIM-type containing 3
Synonyms4921517A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6417 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164805098-164822130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164820733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 378 (V378M)
Ref Sequence ENSEMBL: ENSMUSP00000050970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017908] [ENSMUST00000052107] [ENSMUST00000132282]
Predicted Effect probably benign
Transcript: ENSMUST00000017908
SMART Domains Protein: ENSMUSP00000017908
Gene: ENSMUSG00000017764

DomainStartEndE-ValueType
Pfam:SWIM 342 375 2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052107
AA Change: V378M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050970
Gene: ENSMUSG00000045822
AA Change: V378M

DomainStartEndE-ValueType
low complexity region 436 453 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
ZnF_PMZ 546 573 2.09e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132282
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,397,128 K1426E possibly damaging Het
Abra C T 15: 41,866,056 R316H probably benign Het
Adam7 T A 14: 68,504,621 T729S probably benign Het
Arhgef17 A G 7: 100,930,062 S560P probably damaging Het
Asb13 G A 13: 3,643,574 V111I probably damaging Het
Eif2ak2 A C 17: 78,856,619 L439R probably damaging Het
Lrrk2 C T 15: 91,812,346 R2446C probably benign Het
Map3k10 A G 7: 27,663,284 F459S probably damaging Het
Med1 T C 11: 98,157,228 D914G probably damaging Het
Olfr1085 A T 2: 86,658,166 C97* probably null Het
Olfr1425 T G 19: 12,073,960 K224T probably benign Het
Olfr1449 A C 19: 12,935,220 T161P probably damaging Het
Olfr887 T A 9: 38,085,594 S253T probably benign Het
Olfr890 T G 9: 38,143,315 L55R probably damaging Het
Pkd1l2 C T 8: 117,013,899 C2153Y probably damaging Het
Plk5 T C 10: 80,364,072 V471A probably benign Het
Scn1a A G 2: 66,273,198 I1906T probably damaging Het
Slc16a12 T C 19: 34,672,697 probably null Het
Slc25a23 T C 17: 57,052,780 I324V probably damaging Het
Sord A T 2: 122,264,121 K330M possibly damaging Het
Srp54b T A 12: 55,250,070 F184L probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcte1 A G 17: 45,535,130 E220G probably damaging Het
Tfrc C T 16: 32,630,239 T732I probably damaging Het
Tnrc6a A G 7: 123,171,074 T696A probably benign Het
Ttn A G 2: 76,712,275 Y33456H possibly damaging Het
Unc45a C G 7: 80,339,652 E23Q probably benign Het
Urb2 C T 8: 124,047,199 R1490W probably damaging Het
Wdr64 A T 1: 175,726,390 D162V probably damaging Het
Zfp959 G A 17: 55,898,094 G377D probably damaging Het
Other mutations in Zswim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Zswim3 APN 2 164821091 missense probably damaging 1.00
IGL01345:Zswim3 APN 2 164820137 missense probably damaging 1.00
IGL01608:Zswim3 APN 2 164821520 missense probably damaging 1.00
IGL01621:Zswim3 APN 2 164821520 missense probably damaging 1.00
IGL01634:Zswim3 APN 2 164820002 missense probably damaging 0.99
IGL02165:Zswim3 APN 2 164821115 missense possibly damaging 0.94
IGL02173:Zswim3 APN 2 164820839 missense probably damaging 1.00
IGL02336:Zswim3 APN 2 164820377 missense probably damaging 0.98
IGL02379:Zswim3 APN 2 164820682 unclassified probably null
R0321:Zswim3 UTSW 2 164820359 missense possibly damaging 0.83
R1489:Zswim3 UTSW 2 164819981 missense probably benign 0.00
R2126:Zswim3 UTSW 2 164819993 missense probably benign 0.31
R2176:Zswim3 UTSW 2 164820694 missense probably benign 0.08
R2859:Zswim3 UTSW 2 164820389 missense probably damaging 1.00
R3853:Zswim3 UTSW 2 164820857 missense possibly damaging 0.61
R4434:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4435:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4436:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4438:Zswim3 UTSW 2 164820643 missense probably benign 0.00
R4805:Zswim3 UTSW 2 164820179 missense possibly damaging 0.52
R5874:Zswim3 UTSW 2 164820112 missense probably benign 0.06
R6420:Zswim3 UTSW 2 164820733 missense probably damaging 0.97
R6722:Zswim3 UTSW 2 164820624 unclassified probably null
R6786:Zswim3 UTSW 2 164820851 missense probably damaging 1.00
R7266:Zswim3 UTSW 2 164820482 missense probably benign 0.41
R7467:Zswim3 UTSW 2 164819875 missense possibly damaging 0.59
R7487:Zswim3 UTSW 2 164820215 missense probably damaging 0.99
R7788:Zswim3 UTSW 2 164819779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCACTCGTCTCTTGGAG -3'
(R):5'- CTCCTTAACTTGGGAGCATTTG -3'

Sequencing Primer
(F):5'- CGTCTCTTGGAGAAGAAGTTACACC -3'
(R):5'- CATTTGTGGGCAAGCTCTTCAGAC -3'
Posted On2018-05-24