Incidental Mutation 'R6425:Atp6v0a4'
ID518289
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene NameATPase, H+ transporting, lysosomal V0 subunit A4
SynonymsV-ATPase alpha 4, Atp6n1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6425 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38048483-38124586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38050511 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 788 (V788D)
Ref Sequence ENSEMBL: ENSMUSP00000110558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000096040] [ENSMUST00000114908]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040259
AA Change: V788D

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: V788D

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040486
Predicted Effect probably benign
Transcript: ENSMUST00000096040
SMART Domains Protein: ENSMUSP00000093743
Gene: ENSMUSG00000029830

DomainStartEndE-ValueType
Pfam:Sugar_tr 17 297 5.5e-20 PFAM
Pfam:MFS_1 50 308 2.1e-20 PFAM
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 384 406 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114908
AA Change: V788D

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: V788D

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135594
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,329,232 T3A possibly damaging Het
Ash1l A G 3: 88,983,780 T989A probably damaging Het
Atp6v0a2 T A 5: 124,713,130 L459Q probably damaging Het
Auh G A 13: 52,841,044 R162C probably damaging Het
Begain C A 12: 109,033,394 G689C probably damaging Het
Cd300lg T C 11: 102,046,923 F193S probably benign Het
Cenpf T G 1: 189,659,898 N579T probably benign Het
Cfap65 T C 1: 74,927,709 H273R probably benign Het
Col6a6 T C 9: 105,698,865 T2099A probably benign Het
Dock1 A G 7: 135,163,381 K1701E possibly damaging Het
Dtl T C 1: 191,546,623 I376V probably benign Het
F830045P16Rik C A 2: 129,460,580 C364F probably damaging Het
Fancl C T 11: 26,399,680 L63F probably damaging Het
Gli2 A T 1: 118,835,894 L1509* probably null Het
Glyr1 A T 16: 5,036,486 probably null Het
Gm5136 A C 10: 108,699,896 M66R possibly damaging Het
Igkv6-32 A T 6: 70,074,300 M24K probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klhl18 T C 9: 110,446,681 E133G possibly damaging Het
Lgals4 A T 7: 28,834,460 K20* probably null Het
Myo9b A G 8: 71,333,628 D646G probably damaging Het
Pcdhb3 T C 18: 37,302,475 L498P possibly damaging Het
Pcdhgb4 T C 18: 37,721,587 V345A possibly damaging Het
Pdc T C 1: 150,333,372 V202A probably benign Het
Pfas T C 11: 68,991,071 I929M probably benign Het
Plxna1 G T 6: 89,334,665 R953S probably benign Het
Pnpla5 T C 15: 84,122,635 probably null Het
Psmd1 T C 1: 86,070,628 probably null Het
Rbm47 C T 5: 66,022,816 G452S probably damaging Het
Reln G A 5: 21,911,020 Q2997* probably null Het
Rrn3 A G 16: 13,811,601 T594A probably benign Het
Slc25a35 G A 11: 68,968,765 A35T possibly damaging Het
Slc33a1 A G 3: 63,964,063 V43A probably benign Het
Sorcs3 T C 19: 48,764,307 probably null Het
Tbk1 A G 10: 121,563,962 M319T probably benign Het
Tmem132c T A 5: 127,553,265 M622K possibly damaging Het
Tshz1 A T 18: 84,015,563 F240Y probably damaging Het
Ube2b A T 11: 51,991,417 L73* probably null Het
Vipas39 A G 12: 87,241,289 V449A probably damaging Het
Zfp870 T C 17: 32,883,071 N429S possibly damaging Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 unclassified probably null
R5698:Atp6v0a4 UTSW 6 38050507 unclassified probably null
R7659:Atp6v0a4 UTSW 6 38071972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGAGGGCTTCATGACAGG -3'
(R):5'- ACCGAGCAGATGTATCCGTG -3'

Sequencing Primer
(F):5'- GCACATCTGCGTACATGTG -3'
(R):5'- GAGCAGATGTATCCGTGACCCAC -3'
Posted On2018-05-24