Mutagenetix > Incidental Mutations

Incidental Mutation 'R6425:Atp6v0a4'

518289

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a4

Ensembl Gene

ENSMUSG00000038600

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A4

Synonyms

V-ATPase alpha 4, Atp6n1b

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6425 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38048483-38124586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38050511 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 788 (V788D)

Ref Sequence

ENSEMBL: ENSMUSP00000110558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000096040] [ENSMUST00000114908]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040259
AA Change: V788D

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: V788D

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	824	3.5e-293	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000040486

Predicted Effect

probably benign
Transcript: ENSMUST00000096040

SMART Domains

Protein: ENSMUSP00000093743
Gene: ENSMUSG00000029830

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	17	297	5.5e-20	PFAM
Pfam:MFS_1	50	308	2.1e-20	PFAM
transmembrane domain	349	371	N/A	INTRINSIC
transmembrane domain	384	406	N/A	INTRINSIC
transmembrane domain	459	481	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114908
AA Change: V788D

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: V788D

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	823	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135594

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	C	11: 110,329,232	T3A	possibly damaging	Het
Ash1l	A	G	3: 88,983,780	T989A	probably damaging	Het
Atp6v0a2	T	A	5: 124,713,130	L459Q	probably damaging	Het
Auh	G	A	13: 52,841,044	R162C	probably damaging	Het
Begain	C	A	12: 109,033,394	G689C	probably damaging	Het
Cd300lg	T	C	11: 102,046,923	F193S	probably benign	Het
Cenpf	T	G	1: 189,659,898	N579T	probably benign	Het
Cfap65	T	C	1: 74,927,709	H273R	probably benign	Het
Col6a6	T	C	9: 105,698,865	T2099A	probably benign	Het
Dock1	A	G	7: 135,163,381	K1701E	possibly damaging	Het
Dtl	T	C	1: 191,546,623	I376V	probably benign	Het
F830045P16Rik	C	A	2: 129,460,580	C364F	probably damaging	Het
Fancl	C	T	11: 26,399,680	L63F	probably damaging	Het
Gli2	A	T	1: 118,835,894	L1509*	probably null	Het
Glyr1	A	T	16: 5,036,486		probably null	Het
Gm5136	A	C	10: 108,699,896	M66R	possibly damaging	Het
Igkv6-32	A	T	6: 70,074,300	M24K	probably damaging	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Klhl18	T	C	9: 110,446,681	E133G	possibly damaging	Het
Lgals4	A	T	7: 28,834,460	K20*	probably null	Het
Myo9b	A	G	8: 71,333,628	D646G	probably damaging	Het
Pcdhb3	T	C	18: 37,302,475	L498P	possibly damaging	Het
Pcdhgb4	T	C	18: 37,721,587	V345A	possibly damaging	Het
Pdc	T	C	1: 150,333,372	V202A	probably benign	Het
Pfas	T	C	11: 68,991,071	I929M	probably benign	Het
Plxna1	G	T	6: 89,334,665	R953S	probably benign	Het
Pnpla5	T	C	15: 84,122,635		probably null	Het
Psmd1	T	C	1: 86,070,628		probably null	Het
Rbm47	C	T	5: 66,022,816	G452S	probably damaging	Het
Reln	G	A	5: 21,911,020	Q2997*	probably null	Het
Rrn3	A	G	16: 13,811,601	T594A	probably benign	Het
Slc25a35	G	A	11: 68,968,765	A35T	possibly damaging	Het
Slc33a1	A	G	3: 63,964,063	V43A	probably benign	Het
Sorcs3	T	C	19: 48,764,307		probably null	Het
Tbk1	A	G	10: 121,563,962	M319T	probably benign	Het
Tmem132c	T	A	5: 127,553,265	M622K	possibly damaging	Het
Tshz1	A	T	18: 84,015,563	F240Y	probably damaging	Het
Ube2b	A	T	11: 51,991,417	L73*	probably null	Het
Vipas39	A	G	12: 87,241,289	V449A	probably damaging	Het
Zfp870	T	C	17: 32,883,071	N429S	possibly damaging	Het

Other mutations in Atp6v0a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Atp6v0a4	APN	6	38092790	nonsense	probably null
IGL01358:Atp6v0a4	APN	6	38074210	missense	probably damaging	1.00
IGL01781:Atp6v0a4	APN	6	38074160	missense	possibly damaging	0.91
IGL01934:Atp6v0a4	APN	6	38051546	missense	possibly damaging	0.90
IGL01953:Atp6v0a4	APN	6	38054617	missense	probably damaging	0.97
IGL03190:Atp6v0a4	APN	6	38054556	missense	probably benign	0.02
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0100:Atp6v0a4	UTSW	6	38076815	missense	probably benign
R0105:Atp6v0a4	UTSW	6	38053129	splice site	probably benign
R1569:Atp6v0a4	UTSW	6	38050625	missense	probably damaging	1.00
R1754:Atp6v0a4	UTSW	6	38067829	missense	probably benign
R2142:Atp6v0a4	UTSW	6	38082936	nonsense	probably null
R2162:Atp6v0a4	UTSW	6	38088646	missense	possibly damaging	0.89
R2433:Atp6v0a4	UTSW	6	38082029	critical splice donor site	probably null
R2892:Atp6v0a4	UTSW	6	38053017	missense	probably benign	0.00
R4599:Atp6v0a4	UTSW	6	38078802	missense	probably benign	0.01
R4687:Atp6v0a4	UTSW	6	38092465	missense	possibly damaging	0.95
R4716:Atp6v0a4	UTSW	6	38061064	missense	probably damaging	1.00
R4938:Atp6v0a4	UTSW	6	38078814	missense	possibly damaging	0.80
R5062:Atp6v0a4	UTSW	6	38074183	missense	probably benign	0.05
R5437:Atp6v0a4	UTSW	6	38076733	missense	probably damaging	0.97
R5440:Atp6v0a4	UTSW	6	38092817	missense	probably damaging	0.96
R5697:Atp6v0a4	UTSW	6	38050507	unclassified	probably null
R5698:Atp6v0a4	UTSW	6	38050507	unclassified	probably null
R7659:Atp6v0a4	UTSW	6	38071972	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATGAGGGCTTCATGACAGG -3'
(R):5'- ACCGAGCAGATGTATCCGTG -3'

Sequencing Primer
(F):5'- GCACATCTGCGTACATGTG -3'
(R):5'- GAGCAGATGTATCCGTGACCCAC -3'

Posted On

2018-05-24