Incidental Mutation 'R6427:Ccnc'
ID518352
Institutional Source Beutler Lab
Gene Symbol Ccnc
Ensembl Gene ENSMUSG00000028252
Gene Namecyclin C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6427 (G1)
Quality Score155.008
Status Validated
Chromosome4
Chromosomal Location21727701-21759922 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 21747578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065928] [ENSMUST00000102997] [ENSMUST00000108240] [ENSMUST00000120679]
Predicted Effect probably null
Transcript: ENSMUST00000065928
SMART Domains Protein: ENSMUSP00000069076
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102997
SMART Domains Protein: ENSMUSP00000100062
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108240
SMART Domains Protein: ENSMUSP00000103875
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120679
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133712
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die prenatally and exhibit growth retardation and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Ccnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ccnc APN 4 21742642 nonsense probably null
IGL01536:Ccnc APN 4 21732505 missense probably benign 0.01
IGL03083:Ccnc APN 4 21742683 missense possibly damaging 0.83
R1220:Ccnc UTSW 4 21732491 missense probably damaging 1.00
R1237:Ccnc UTSW 4 21730457 missense probably benign
R1558:Ccnc UTSW 4 21742671 missense probably benign 0.31
R2012:Ccnc UTSW 4 21741955 missense possibly damaging 0.65
R4901:Ccnc UTSW 4 21727894 missense probably damaging 0.96
R6509:Ccnc UTSW 4 21740642 missense probably benign 0.27
R7421:Ccnc UTSW 4 21743291 missense probably damaging 1.00
R7563:Ccnc UTSW 4 21732220 missense probably damaging 0.99
R7842:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R7925:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R8023:Ccnc UTSW 4 21747578 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGCTGGTTACAGTGGTG -3'
(R):5'- AGCAGTCTGGAAGTTAGTGTC -3'

Sequencing Primer
(F):5'- TACAGTGGTGTCGAGTTGAGAAG -3'
(R):5'- CAGTCTGGAAGTTAGTGTCCATATAC -3'
Posted On2018-05-24