Incidental Mutation 'R6427:Nlrp4e'
ID518359
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6427 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23320633 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 182 (S182T)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076470
AA Change: S182T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: S182T

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAAAGATCAAGATTCCCTTAAGCAG -3'
(R):5'- TGCAGTCATCACACAGCTCC -3'

Sequencing Primer
(F):5'- CAGAAATTTACCCAGGATGACTGTG -3'
(R):5'- AGCTCCGACTCCCATTCAG -3'
Posted On2018-05-24