Incidental Mutation 'R6162:Adh4'
ID519606
Institutional Source Beutler Lab
Gene Symbol Adh4
Ensembl Gene ENSMUSG00000037797
Gene Namealcohol dehydrogenase 4 (class II), pi polypeptide
SynonymsAdh2, mouse class II type ADH
MMRRC Submission 044309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6162 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138415466-138430892 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 138415489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000013458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013458] [ENSMUST00000161312]
PDB Structure
Mouse class II alcohol dehydrogenase complex with NADH [X-RAY DIFFRACTION]
Mouse class II alcohol dehydrogenase complex with NADH and inhibitor [X-RAY DIFFRACTION]
P47H MUTANT OF MOUSE CLASS II ALCOHOL DEHYDROGENASE COMPLEX WITH NADH [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000013458
SMART Domains Protein: ENSMUSP00000013458
Gene: ENSMUSG00000037797

DomainStartEndE-ValueType
Pfam:ADH_N 34 165 3.1e-23 PFAM
Pfam:ADH_zinc_N 207 337 8.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161312
SMART Domains Protein: ENSMUSP00000124163
Gene: ENSMUSG00000037797

DomainStartEndE-ValueType
Pfam:ADH_N 46 177 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162260
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Aox3 A T 1: 58,159,731 D695V possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Gprc6a T A 10: 51,614,912 I739F probably benign Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Lmf1 A G 17: 25,612,394 I205V probably benign Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Vmn2r12 A G 5: 109,086,564 L594P probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Adh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Adh4 APN 3 138420636 missense probably damaging 0.99
IGL01450:Adh4 APN 3 138424033 missense probably benign 0.05
IGL01608:Adh4 APN 3 138429027 unclassified probably benign
IGL01618:Adh4 APN 3 138429027 unclassified probably benign
IGL01621:Adh4 APN 3 138429027 unclassified probably benign
IGL01640:Adh4 APN 3 138429027 unclassified probably benign
IGL01979:Adh4 APN 3 138429027 unclassified probably benign
IGL01982:Adh4 APN 3 138429027 unclassified probably benign
IGL01993:Adh4 APN 3 138429027 unclassified probably benign
IGL02720:Adh4 APN 3 138419220 missense possibly damaging 0.87
IGL03030:Adh4 APN 3 138429145 missense probably benign 0.13
PIT4403001:Adh4 UTSW 3 138424178 missense probably damaging 0.97
R0295:Adh4 UTSW 3 138429076 missense probably damaging 1.00
R0308:Adh4 UTSW 3 138424102 missense probably damaging 1.00
R0636:Adh4 UTSW 3 138428074 missense probably damaging 1.00
R1450:Adh4 UTSW 3 138424174 missense probably damaging 1.00
R4824:Adh4 UTSW 3 138429046 missense possibly damaging 0.81
R5137:Adh4 UTSW 3 138422235 missense probably benign 0.00
R5263:Adh4 UTSW 3 138428055 missense probably benign 0.00
R5566:Adh4 UTSW 3 138424189 missense probably damaging 1.00
R7297:Adh4 UTSW 3 138429140 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GATGGAGATGACCTTTGCTTAGTAAC -3'
(R):5'- ACTTCAGTCGCTGTGCCTTG -3'

Sequencing Primer
(F):5'- TGCACTTTGTCTAGTTGATACATTG -3'
(R):5'- TGCCTTGAGTGTAACCCGGAAG -3'
Posted On2018-06-04