Incidental Mutation 'R6693:Cpeb2'
List |< first << previous [record 9 of 36] next >> last >|
ID528166
Institutional Source Beutler Lab
Gene Symbol Cpeb2
Ensembl Gene ENSMUSG00000039782
Gene Namecytoplasmic polyadenylation element binding protein 2
SynonymsA630055H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43233170-43289724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43285912 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 982 (D982V)
Ref Sequence ENSEMBL: ENSMUSP00000125857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114066] [ENSMUST00000166713] [ENSMUST00000169035]
Predicted Effect unknown
Transcript: ENSMUST00000114065
AA Change: D838V
SMART Domains Protein: ENSMUSP00000109699
Gene: ENSMUSG00000039782
AA Change: D838V

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
RRM 265 337 1.5e-4 SMART
RRM 373 446 1.86e-2 SMART
PDB:2M13|A 447 512 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114066
SMART Domains Protein: ENSMUSP00000109700
Gene: ENSMUSG00000039782

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
RRM 273 345 1.5e-4 SMART
RRM 381 454 1.86e-2 SMART
PDB:2M13|A 455 520 1e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000166713
AA Change: D1012V
SMART Domains Protein: ENSMUSP00000130921
Gene: ENSMUSG00000039782
AA Change: D1012V

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
RRM 758 830 1.5e-4 SMART
RRM 866 939 1.86e-2 SMART
PDB:2M13|A 940 1005 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000169035
AA Change: D982V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125857
Gene: ENSMUSG00000039782
AA Change: D982V

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
RRM 736 808 1.5e-4 SMART
RRM 844 917 1.86e-2 SMART
PDB:2M13|A 918 983 2e-6 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, decreased heart rate, and increased parasympathetic signaling leading to increased pulmonary acetylcholine level, bronchoconstriction, severe apnea, and abnormal breathing patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Cpeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Cpeb2 APN 5 43285831 missense probably damaging 0.98
IGL00771:Cpeb2 APN 5 43237547 missense possibly damaging 0.94
IGL00797:Cpeb2 APN 5 43281447 missense probably damaging 1.00
IGL01604:Cpeb2 APN 5 43278695 critical splice donor site probably null
IGL01632:Cpeb2 APN 5 43237422 missense probably benign 0.25
IGL03137:Cpeb2 APN 5 43261724 splice site probably benign
R0125:Cpeb2 UTSW 5 43238400 intron probably benign
R0200:Cpeb2 UTSW 5 43261776 missense possibly damaging 0.57
R0453:Cpeb2 UTSW 5 43285713 splice site probably benign
R1411:Cpeb2 UTSW 5 43233770 unclassified probably benign
R1542:Cpeb2 UTSW 5 43285875 missense probably damaging 1.00
R1563:Cpeb2 UTSW 5 43285737 missense probably damaging 1.00
R1573:Cpeb2 UTSW 5 43283930 splice site probably benign
R1703:Cpeb2 UTSW 5 43233838 unclassified probably benign
R1899:Cpeb2 UTSW 5 43277587 missense probably damaging 1.00
R1942:Cpeb2 UTSW 5 43235253 intron probably benign
R3429:Cpeb2 UTSW 5 43281230 critical splice donor site probably null
R3610:Cpeb2 UTSW 5 43285933 missense probably damaging 0.98
R3848:Cpeb2 UTSW 5 43237445 missense probably damaging 0.97
R4005:Cpeb2 UTSW 5 43238412 intron probably benign
R4306:Cpeb2 UTSW 5 43235235 intron probably benign
R4667:Cpeb2 UTSW 5 43233892 unclassified probably benign
R4754:Cpeb2 UTSW 5 43285857 missense possibly damaging 0.93
R4821:Cpeb2 UTSW 5 43233474 unclassified probably benign
R4906:Cpeb2 UTSW 5 43244662 missense possibly damaging 0.50
R5237:Cpeb2 UTSW 5 43285756 missense probably damaging 0.99
R7473:Cpeb2 UTSW 5 43277505 missense
R7825:Cpeb2 UTSW 5 43237539 missense probably damaging 1.00
R8138:Cpeb2 UTSW 5 43235009 missense
R8162:Cpeb2 UTSW 5 43237338 missense
R8735:Cpeb2 UTSW 5 43281432 nonsense probably null
Z1176:Cpeb2 UTSW 5 43234717 missense
Predicted Primers PCR Primer
(F):5'- AGCAGACTCCACAGAGGTTTC -3'
(R):5'- CTGCTGATAACGATGCATGTATC -3'

Sequencing Primer
(F):5'- AGCCATATGTGCTAGATGACC -3'
(R):5'- ATGCATGTATCGAGAGCTGG -3'
Posted On2018-07-24