Mutagenetix > Incidental Mutations

Incidental Mutation 'R6750:Ifngr1'

530716

Institutional Source

Beutler Lab

Gene Symbol

Ifngr1

Ensembl Gene

ENSMUSG00000020009

Gene Name

interferon gamma receptor 1

Synonyms

CD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6750 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19591949-19610229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19609351 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 366 (M366K)

Ref Sequence

ENSEMBL: ENSMUSP00000020188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]

Predicted Effect

probably benign
Transcript: ENSMUST00000020188
AA Change: M366K

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009
AA Change: M366K

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	119	2.2e-27	PFAM
Pfam:Interfer-bind	131	245	8.5e-9	PFAM
Pfam:IFNGR1	168	331	1.6e-53	PFAM
low complexity region	401	416	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164591

SMART Domains

Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	74	2.3e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168074

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	T	17: 33,066,398	S477T	possibly damaging	Het
5430419D17Rik	T	A	7: 131,288,245		probably benign	Het
Adal	A	T	2: 121,142,649	L62F	probably damaging	Het
Akap13	C	T	7: 75,739,458	P2375S	probably benign	Het
Apob	T	A	12: 7,997,853	L931Q	probably damaging	Het
Arcn1	A	G	9: 44,750,394	V391A	possibly damaging	Het
Ccdc162	A	T	10: 41,561,226	I1729N	possibly damaging	Het
Cd24a	T	C	10: 43,582,725	L86P	unknown	Het
Churc1	C	A	12: 76,775,631	H71Q	probably damaging	Het
Clcn3	A	G	8: 60,914,775	L780P	possibly damaging	Het
Cldn17	C	T	16: 88,506,307	G178E	possibly damaging	Het
Cmah	A	G	13: 24,464,252	Y345C	probably damaging	Het
Cntnap5b	C	T	1: 100,274,499	S357L	probably damaging	Het
Col6a6	A	G	9: 105,783,680	I410T	probably damaging	Het
Crmp1	T	C	5: 37,265,322		probably null	Het
Csmd2	A	C	4: 128,197,225	N186H	possibly damaging	Het
Cyp1a1	A	T	9: 57,700,256	M56L	probably benign	Het
D2hgdh	G	C	1: 93,826,407	R56P	probably benign	Het
Dapk2	A	G	9: 66,220,752	E104G	probably damaging	Het
Dld	T	C	12: 31,332,214	N498S	probably benign	Het
Dyrk4	G	T	6: 126,898,955	Q106K	probably benign	Het
Eif2b4	T	C	5: 31,189,960	I333V	probably damaging	Het
F5	A	G	1: 164,193,507	T1184A	possibly damaging	Het
Fbxl6	C	T	15: 76,538,412	G102D	probably damaging	Het
Foxa1	C	T	12: 57,542,610	G275R	probably benign	Het
Fryl	A	G	5: 73,022,232	I2944T	probably damaging	Het
Gm597	C	A	1: 28,777,414	E512D	probably damaging	Het
Gna15	T	C	10: 81,514,283	D95G	probably benign	Het
Greb1	T	A	12: 16,688,583	M1460L	probably benign	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Herc2	T	C	7: 56,097,447	I444T	probably damaging	Het
Krt27	C	T	11: 99,348,980	E253K	probably damaging	Het
Micalcl	C	T	7: 112,381,839	T406I	probably damaging	Het
Mocs2	T	G	13: 114,826,248	D156E	probably damaging	Het
Mprip	A	T	11: 59,696,131	K43N	probably damaging	Het
Myo5b	A	T	18: 74,617,035	T190S	possibly damaging	Het
Naa25	C	T	5: 121,408,309	T86M	probably damaging	Het
Ncam1	T	C	9: 49,567,339	D163G	probably damaging	Het
Nlrp4f	A	T	13: 65,181,654	Y908*	probably null	Het
Nlrp9b	T	A	7: 20,023,234	L132*	probably null	Het
Nrg1	A	C	8: 31,818,096	S679A	probably damaging	Het
Olfr3	C	A	2: 36,812,942	R50M	possibly damaging	Het
Olfr656	C	T	7: 104,618,113	R145C	probably damaging	Het
Paqr9	A	T	9: 95,560,997	T347S	probably damaging	Het
Pcdhb21	T	C	18: 37,514,448	L210P	probably damaging	Het
Pdzd7	T	G	19: 45,027,748	D978A	probably benign	Het
Pkd1l1	A	T	11: 8,973,217	S17T	unknown	Het
Plcz1	T	C	6: 140,028,438	K93E	possibly damaging	Het
Pom121l2	G	C	13: 21,981,937	R126P	probably damaging	Het
Prkg1	C	T	19: 31,764,561	E88K	probably benign	Het
Psme4	A	T	11: 30,853,203	D15V	probably damaging	Het
Ptprf	A	G	4: 118,231,731	V625A	probably benign	Het
Rab27a	G	A	9: 73,085,008	S106N	probably damaging	Het
Rasa4	A	G	5: 136,100,948	T261A	probably benign	Het
Sardh	T	C	2: 27,228,257	D487G	probably benign	Het
Sec16a	A	G	2: 26,440,018	Y662H	probably benign	Het
Sema3d	T	A	5: 12,585,100	L711*	probably null	Het
Sept14	T	A	5: 129,696,117	Y152F	probably damaging	Het
Smc5	A	G	19: 23,242,640	L411P	probably damaging	Het
Spg7	T	A	8: 123,073,911	V39E	probably damaging	Het
Tas2r117	A	G	6: 132,802,854		probably benign	Het
Tle1	A	T	4: 72,122,450	I631N	probably damaging	Het
Tmed3	T	A	9: 89,699,790	S207C	probably damaging	Het
Tmem59l	G	A	8: 70,486,372	P51S	probably benign	Het
Trpc3	A	G	3: 36,624,393	Y848H	probably damaging	Het
Tsen2	T	C	6: 115,549,920	F66S	probably damaging	Het
Ttll5	T	A	12: 85,956,610	S216R	probably damaging	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vmn2r76	T	C	7: 86,225,906	N621S	probably damaging	Het
Wdr75	A	G	1: 45,817,379	T521A	probably damaging	Het
Wrnip1	T	A	13: 32,802,756	D173E	probably damaging	Het
Zfp317	G	A	9: 19,647,804	G438D	probably damaging	Het
Zscan10	T	A	17: 23,607,190	S109T	possibly damaging	Het

Other mutations in Ifngr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ifngr1	APN	10	19609198	missense	probably damaging	0.99
IGL01125:Ifngr1	APN	10	19597413	splice site	probably benign
IGL01366:Ifngr1	APN	10	19609600	missense	probably damaging	1.00
IGL01951:Ifngr1	APN	10	19609454	missense	possibly damaging	0.94
IGL02037:Ifngr1	APN	10	19607259	missense	probably benign	0.26
Marigold	UTSW	10	19601485	critical splice donor site	probably null
BB007:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
BB017:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
R0023:Ifngr1	UTSW	10	19609449	nonsense	probably null
R0325:Ifngr1	UTSW	10	19597432	missense	probably damaging	1.00
R0590:Ifngr1	UTSW	10	19603942	splice site	probably benign
R1305:Ifngr1	UTSW	10	19606253	missense	possibly damaging	0.91
R1496:Ifngr1	UTSW	10	19601445	missense	probably benign	0.04
R1597:Ifngr1	UTSW	10	19609342	missense	probably damaging	0.99
R2019:Ifngr1	UTSW	10	19592113	missense	probably damaging	0.99
R2302:Ifngr1	UTSW	10	19609645	missense	probably damaging	1.00
R2484:Ifngr1	UTSW	10	19601415	missense	probably damaging	1.00
R4089:Ifngr1	UTSW	10	19601485	critical splice donor site	probably null
R4464:Ifngr1	UTSW	10	19597517	missense	possibly damaging	0.75
R4863:Ifngr1	UTSW	10	19609416	missense	probably damaging	1.00
R6045:Ifngr1	UTSW	10	19609161	missense	possibly damaging	0.61
R6047:Ifngr1	UTSW	10	19606313	missense	probably damaging	1.00
R6089:Ifngr1	UTSW	10	19606300	missense	probably benign	0.01
R6950:Ifngr1	UTSW	10	19607293	missense	probably damaging	0.99
R7162:Ifngr1	UTSW	10	19609353	missense	probably benign
R7930:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
R8178:Ifngr1	UTSW	10	19609493	missense	probably benign	0.03
R8436:Ifngr1	UTSW	10	19603805	missense	probably damaging	1.00
T0975:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98
X0005:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTATTCACTTGTCACACCGC -3'
(R):5'- AACATGTGCGGTTTGTCATAACC -3'

Sequencing Primer
(F):5'- CACCAGCCAGCTGTCCTAGAG -3'
(R):5'- ATGGGGGCCTTTCTCACG -3'

Posted On

2018-08-01