Incidental Mutation 'R6902:Gpr132'
ID538608
Institutional Source Beutler Lab
Gene Symbol Gpr132
Ensembl Gene ENSMUSG00000021298
Gene NameG protein-coupled receptor 132
SynonymsG2a, G2 accumulation
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112850873-112868228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112852210 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 332 (Y332F)
Ref Sequence ENSEMBL: ENSMUSP00000021729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021729] [ENSMUST00000222776]
Predicted Effect probably benign
Transcript: ENSMUST00000021729
AA Change: Y332F

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021729
Gene: ENSMUSG00000021298
AA Change: Y332F

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
Pfam:7tm_1 56 306 6.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222776
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein was reported to be a receptor for lysophosphatidylcholine action, but PubMedID: 15653487 retracts this finding and instead suggests this protein to be an effector of lysophosphatidylcholine action. This protein may have proton-sensing activity and may be a receptor for oxidized free fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but eventually develop a "late onset lymphoproliferative autoimmune syndrome" [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Gpr132
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Gpr132 APN 12 112852855 missense probably damaging 1.00
R1454:Gpr132 UTSW 12 112852240 missense possibly damaging 0.78
R1785:Gpr132 UTSW 12 112852403 missense probably damaging 1.00
R1786:Gpr132 UTSW 12 112852403 missense probably damaging 1.00
R2133:Gpr132 UTSW 12 112852403 missense probably damaging 1.00
R3899:Gpr132 UTSW 12 112852108 missense probably benign 0.05
R3913:Gpr132 UTSW 12 112853020 missense probably benign 0.03
R5226:Gpr132 UTSW 12 112852148 missense probably benign 0.00
R5662:Gpr132 UTSW 12 112852796 missense probably damaging 1.00
R5665:Gpr132 UTSW 12 112852796 missense probably damaging 1.00
R5805:Gpr132 UTSW 12 112852796 missense probably damaging 1.00
R5807:Gpr132 UTSW 12 112852796 missense probably damaging 1.00
R5907:Gpr132 UTSW 12 112852097 missense probably benign
R6946:Gpr132 UTSW 12 112852210 missense probably benign 0.39
R7218:Gpr132 UTSW 12 112852429 missense probably damaging 1.00
R7543:Gpr132 UTSW 12 112852202 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTATAGTGCTGTGGACACCCC -3'
(R):5'- CCGTGTGTGCCTTTGAAAGC -3'

Sequencing Primer
(F):5'- CTCAGAGGACCAGGTATGTGTGAC -3'
(R):5'- GTGCCTTTGAAAGCAGACTGTACAC -3'
Posted On2018-11-06