Incidental Mutation 'R6902:Mier2'
ID538605
Institutional Source Beutler Lab
Gene Symbol Mier2
Ensembl Gene ENSMUSG00000042570
Gene NameMIER family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79540245-79555199 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to A at 79540839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062855] [ENSMUST00000165028] [ENSMUST00000172158]
Predicted Effect probably benign
Transcript: ENSMUST00000062855
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165028
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172158
AA Change: R84L
SMART Domains Protein: ENSMUSP00000129732
Gene: ENSMUSG00000042570
AA Change: R84L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Mier2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mier2 APN 10 79541180 makesense probably null
IGL01761:Mier2 APN 10 79548352 critical splice donor site probably null
IGL01845:Mier2 APN 10 79549584 missense possibly damaging 0.69
IGL02336:Mier2 APN 10 79548350 unclassified probably benign
IGL02882:Mier2 APN 10 79547721 missense probably damaging 1.00
IGL02902:Mier2 APN 10 79549622 missense probably damaging 1.00
R0325:Mier2 UTSW 10 79542596 critical splice donor site probably null
R0972:Mier2 UTSW 10 79544621 unclassified probably benign
R1326:Mier2 UTSW 10 79544709 missense probably damaging 1.00
R1333:Mier2 UTSW 10 79545157 missense probably benign 0.03
R1721:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1867:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1868:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R2015:Mier2 UTSW 10 79541202 splice site probably null
R2273:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R2274:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R3729:Mier2 UTSW 10 79545042 unclassified probably benign
R3874:Mier2 UTSW 10 79541797 missense possibly damaging 0.49
R3881:Mier2 UTSW 10 79548750 unclassified probably null
R4755:Mier2 UTSW 10 79549197 missense probably damaging 1.00
R4758:Mier2 UTSW 10 79550348 missense probably damaging 1.00
R5070:Mier2 UTSW 10 79549577 missense probably benign 0.03
R6282:Mier2 UTSW 10 79544742 missense probably damaging 1.00
R6785:Mier2 UTSW 10 79544713 missense probably damaging 1.00
R6861:Mier2 UTSW 10 79541156 start gained probably benign
R6869:Mier2 UTSW 10 79542669 missense probably damaging 0.99
R6897:Mier2 UTSW 10 79544739 missense probably damaging 0.99
R6946:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6968:Mier2 UTSW 10 79540642 utr 3 prime probably benign
R6971:Mier2 UTSW 10 79542429 missense possibly damaging 0.53
R7072:Mier2 UTSW 10 79540299 missense unknown
R7350:Mier2 UTSW 10 79540298 missense unknown
R7443:Mier2 UTSW 10 79540455 missense unknown
R7506:Mier2 UTSW 10 79550342 missense probably benign 0.14
R7545:Mier2 UTSW 10 79541194 missense possibly damaging 0.79
R7625:Mier2 UTSW 10 79542709 missense probably damaging 1.00
R7669:Mier2 UTSW 10 79549676 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCTTTTCCTGAAGTGAAG -3'
(R):5'- TCTGCTTCAGAACATGGTGGG -3'

Sequencing Primer
(F):5'- GCTTTTCCTGAAGTGAAGACAGCC -3'
(R):5'- CTTCAGAACATGGTGGGATTCAG -3'
Posted On2018-11-06