Incidental Mutation 'R6919:Agbl5'
ID539487
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30904717 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 196 (F196I)
Ref Sequence ENSEMBL: ENSMUSP00000144441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114700] [ENSMUST00000132034] [ENSMUST00000132253] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably benign
Transcript: ENSMUST00000114700
AA Change: F783I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: F783I

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132034
Predicted Effect probably benign
Transcript: ENSMUST00000132253
SMART Domains Protein: ENSMUSP00000128352
Gene: ENSMUSG00000038803

DomainStartEndE-ValueType
Pfam:Ost4 1 35 3.7e-16 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000201168
AA Change: F754I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: F754I

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201225
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201817
AA Change: F754I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: F754I

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201917
AA Change: F754I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: F754I

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202060
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
AA Change: F196I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
R8312:Agbl5 UTSW 5 30894506 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCACTAAACACCCTGCATG -3'
(R):5'- CCCCAGTGTTCACAAGAGTGTC -3'

Sequencing Primer
(F):5'- TCAAGGGCTACTGATAGAGCTC -3'
(R):5'- CTTGATGGGTTCTGCTAATGC -3'
Posted On2018-11-06