Incidental Mutation 'R6950:Hoxb2'
ID541226
Institutional Source Beutler Lab
Gene Symbol Hoxb2
Ensembl Gene ENSMUSG00000075588
Gene Namehomeobox B2
SynonymsHoxbes2, Hox-2.8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location96350525-96354012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96351901 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 31 (T31A)
Ref Sequence ENSEMBL: ENSMUSP00000098092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093944] [ENSMUST00000100523]
Predicted Effect probably benign
Transcript: ENSMUST00000093944
SMART Domains Protein: ENSMUSP00000091476
Gene: ENSMUSG00000048763

DomainStartEndE-ValueType
low complexity region 76 121 N/A INTRINSIC
low complexity region 154 181 N/A INTRINSIC
HOX 191 253 5.44e-28 SMART
low complexity region 256 274 N/A INTRINSIC
Pfam:DUF4074 368 431 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100523
AA Change: T31A

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098092
Gene: ENSMUSG00000075588
AA Change: T31A

DomainStartEndE-ValueType
low complexity region 76 94 N/A INTRINSIC
low complexity region 99 118 N/A INTRINSIC
HOX 141 203 2.54e-28 SMART
low complexity region 204 213 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Hoxb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Hoxb2 APN 11 96353084 missense probably damaging 1.00
R3951:Hoxb2 UTSW 11 96353175 missense probably damaging 0.98
R7103:Hoxb2 UTSW 11 96353621 missense possibly damaging 0.85
R7673:Hoxb2 UTSW 11 96353457 missense possibly damaging 0.83
Z1177:Hoxb2 UTSW 11 96351989 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCTCCATTGCATAAACCTGG -3'
(R):5'- CTTCTCTTTCATCCAGGGGAAC -3'

Sequencing Primer
(F):5'- CCACCATTGAAAGCCATG -3'
(R):5'- TTTCATCCAGGGGAACTCGGG -3'
Posted On2018-11-28