Incidental Mutation 'R6968:Nlrp9b'
ID542105
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene NameNLR family, pyrin domain containing 9B
SynonymsNalp-delta, Nalp9b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19991465-20073306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20049508 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 925 (N925K)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909]
Predicted Effect probably damaging
Transcript: ENSMUST00000073151
AA Change: N925K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: N925K

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
AA Change: N428K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508
AA Change: N428K

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6265:Nlrp9b UTSW 7 20062683 missense probably benign
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 20045766 missense probably benign 0.04
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACATCTTGGGGTCACAAATCC -3'
(R):5'- CAGTGGGTTTGACCTTGAGC -3'

Sequencing Primer
(F):5'- GCTCTGAAACAAGGATTTGCTCAGTG -3'
(R):5'- GGTTTGACCTTGAGCAAACTGACAC -3'
Posted On2018-11-28