Incidental Mutation 'R7065:Pigs'
ID548530
Institutional Source Beutler Lab
Gene Symbol Pigs
Ensembl Gene ENSMUSG00000041958
Gene Namephosphatidylinositol glycan anchor biosynthesis, class S
SynonymsLOC245087, LOC276846
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78328415-78342782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78336739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 243 (V243D)
Ref Sequence ENSEMBL: ENSMUSP00000044871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048073]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048073
AA Change: V243D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958
AA Change: V243D

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Meta Mutation Damage Score 0.7708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca1 G T 4: 53,074,233 S1150Y probably damaging Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gk5 A G 9: 96,179,056 Y531C probably damaging Het
Gpm6a C A 8: 55,037,458 N56K probably benign Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr506 G A 7: 108,613,059 V251I probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Rpgrip1 T C 14: 52,141,193 L525P possibly damaging Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Pigs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Pigs APN 11 78340031 missense probably benign
feral UTSW 11 78336739 missense possibly damaging 0.94
R0094:Pigs UTSW 11 78340038 missense probably damaging 0.98
R0490:Pigs UTSW 11 78335625 missense probably damaging 1.00
R1027:Pigs UTSW 11 78336825 missense probably damaging 1.00
R1073:Pigs UTSW 11 78335605 missense probably benign 0.09
R1157:Pigs UTSW 11 78328994 missense possibly damaging 0.87
R1754:Pigs UTSW 11 78337847 missense probably damaging 0.99
R1881:Pigs UTSW 11 78341756 missense probably benign 0.00
R2171:Pigs UTSW 11 78328812 missense probably damaging 1.00
R2386:Pigs UTSW 11 78332986 missense probably damaging 1.00
R4928:Pigs UTSW 11 78329002 missense probably damaging 0.99
R5206:Pigs UTSW 11 78333723 missense probably damaging 0.98
R5480:Pigs UTSW 11 78329075 missense possibly damaging 0.58
R5665:Pigs UTSW 11 78328769 synonymous probably null
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6039:Pigs UTSW 11 78341825 missense probably damaging 1.00
R6159:Pigs UTSW 11 78328500 missense probably benign 0.01
R6572:Pigs UTSW 11 78339364 missense probably damaging 0.98
R6618:Pigs UTSW 11 78341230 missense probably damaging 1.00
R7052:Pigs UTSW 11 78341385 missense probably damaging 1.00
R7352:Pigs UTSW 11 78328812 missense probably damaging 1.00
R7851:Pigs UTSW 11 78336787 missense probably damaging 1.00
R7934:Pigs UTSW 11 78336787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGCTATATCAGACCTCACTT -3'
(R):5'- TTCCTGGTCTTACCTGAGAGTCC -3'

Sequencing Primer
(F):5'- ACTTCATAGACCAGGCTGAC -3'
(R):5'- GGTCTTACCTGAGAGTCCAC -3'
Posted On2019-05-13