Incidental Mutation 'R7107:Cpsf4l'
ID551269
Institutional Source Beutler Lab
Gene Symbol Cpsf4l
Ensembl Gene ENSMUSG00000018727
Gene Namecleavage and polyadenylation specific factor 4-like
Synonyms1500000C01Rik, 0610010C04Rik, D11Ertd636e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location113698172-113710017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113702489 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 90 (R90C)
Ref Sequence ENSEMBL: ENSMUSP00000102228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018871] [ENSMUST00000100248] [ENSMUST00000106617] [ENSMUST00000173655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018871
AA Change: R90C

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018871
Gene: ENSMUSG00000018727
AA Change: R90C

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 2.4e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100248
AA Change: R194C

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097819
Gene: ENSMUSG00000018727
AA Change: R194C

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
ZnF_C3H1 89 114 3.38e-1 SMART
ZnF_C3H1 115 141 1.1e-2 SMART
ZnF_C3H1 143 169 4.64e-1 SMART
ZnF_C3H1 173 197 1.36e-2 SMART
ZnF_C3H1 198 221 5.21e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106617
AA Change: R90C

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102228
Gene: ENSMUSG00000018727
AA Change: R90C

DomainStartEndE-ValueType
ZnF_C3H1 10 36 1.1e-2 SMART
ZnF_C3H1 38 64 4.64e-1 SMART
ZnF_C3H1 68 93 2.34e0 SMART
ZnF_C3H1 94 117 5.21e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173655
AA Change: R142C

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133451
Gene: ENSMUSG00000018727
AA Change: R142C

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.33e-1 SMART
ZnF_C3H1 62 88 1.1e-2 SMART
ZnF_C3H1 90 116 4.64e-1 SMART
ZnF_C3H1 120 145 2.34e0 SMART
ZnF_C3H1 146 169 5.21e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Cpsf4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cpsf4l APN 11 113709218 intron probably benign
IGL02132:Cpsf4l APN 11 113699859 missense possibly damaging 0.84
IGL02427:Cpsf4l APN 11 113709498 utr 5 prime probably benign
R0790:Cpsf4l UTSW 11 113706408 splice site probably benign
R1700:Cpsf4l UTSW 11 113702075 missense probably benign 0.17
R1909:Cpsf4l UTSW 11 113703378 splice site probably null
R3522:Cpsf4l UTSW 11 113702493 missense probably damaging 1.00
R4830:Cpsf4l UTSW 11 113709502 utr 5 prime probably benign
R6006:Cpsf4l UTSW 11 113699927 missense probably benign 0.23
R6229:Cpsf4l UTSW 11 113708854 missense possibly damaging 0.89
R6593:Cpsf4l UTSW 11 113709366 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTAGGGAGACACTTGCTAGATG -3'
(R):5'- TACCTGAGCCAAGGTCTCTG -3'

Sequencing Primer
(F):5'- GGAGACACTTGCTAGATGACCTC -3'
(R):5'- AAGGTCTCTGCCCCATCTG -3'
Posted On2019-05-15