Incidental Mutation 'R7122:Olfr347'
ID552052
Institutional Source Beutler Lab
Gene Symbol Olfr347
Ensembl Gene ENSMUSG00000111863
Gene Nameolfactory receptor 347
SynonymsGA_x6K02T2NLDC-33428755-33429693, MOR136-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R7122 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36731902-36737640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36734424 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 34 (M34I)
Ref Sequence ENSEMBL: ENSMUSP00000151158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078761] [ENSMUST00000216882]
Predicted Effect probably benign
Transcript: ENSMUST00000078761
AA Change: M34I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077819
Gene: ENSMUSG00000111863
AA Change: M34I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-5 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216882
AA Change: M34I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Olfr347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02190:Olfr347 APN 2 36734579 missense probably benign 0.03
IGL02417:Olfr347 APN 2 36734344 missense probably benign 0.13
IGL02488:Olfr347 APN 2 36734350 missense probably benign 0.36
IGL02878:Olfr347 APN 2 36734477 missense probably damaging 1.00
IGL03354:Olfr347 APN 2 36734512 missense possibly damaging 0.87
IGL03354:Olfr347 APN 2 36734513 missense possibly damaging 0.89
PIT4403001:Olfr347 UTSW 2 36734918 missense probably damaging 0.99
R0091:Olfr347 UTSW 2 36734905 missense probably damaging 1.00
R0107:Olfr347 UTSW 2 36734718 nonsense probably null
R0457:Olfr347 UTSW 2 36734533 missense probably benign 0.18
R0563:Olfr347 UTSW 2 36735001 nonsense probably null
R1205:Olfr347 UTSW 2 36734755 missense probably benign 0.16
R1599:Olfr347 UTSW 2 36734989 missense probably benign 0.01
R1668:Olfr347 UTSW 2 36735192 nonsense probably null
R1845:Olfr347 UTSW 2 36734842 missense probably damaging 0.99
R1856:Olfr347 UTSW 2 36734345 missense probably benign
R2165:Olfr347 UTSW 2 36734701 missense probably damaging 0.97
R4399:Olfr347 UTSW 2 36735230 missense probably benign 0.00
R4657:Olfr347 UTSW 2 36734403 nonsense probably null
R4684:Olfr347 UTSW 2 36734674 missense probably damaging 1.00
R4767:Olfr347 UTSW 2 36734323 start codon destroyed probably benign 0.02
R4988:Olfr347 UTSW 2 36734984 missense possibly damaging 0.94
R5058:Olfr347 UTSW 2 36734999 missense possibly damaging 0.52
R5103:Olfr347 UTSW 2 36734668 missense probably benign 0.23
R5140:Olfr347 UTSW 2 36734498 missense possibly damaging 0.59
R5587:Olfr347 UTSW 2 36734621 missense probably damaging 1.00
R5591:Olfr347 UTSW 2 36735232 missense probably benign
R6738:Olfr347 UTSW 2 36734432 missense probably benign 0.26
R7097:Olfr347 UTSW 2 36734424 missense probably benign 0.02
R7330:Olfr347 UTSW 2 36735045 nonsense probably null
R7485:Olfr347 UTSW 2 36734638 missense probably benign 0.01
R7792:Olfr347 UTSW 2 36734330 missense probably benign 0.01
R7812:Olfr347 UTSW 2 36734725 missense probably benign
R8303:Olfr347 UTSW 2 36734455 missense probably damaging 1.00
R8824:Olfr347 UTSW 2 36735191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAGAAAGATCTTCACTTTTGG -3'
(R):5'- CACCCAGCATATGAGATGGACTG -3'

Sequencing Primer
(F):5'- CTCCTTTCACTCACAGAAGAA -3'
(R):5'- GACTATGTGTCAGCATATTCATGAGC -3'
Posted On2019-05-15