Mutagenetix > Incidental Mutations

Incidental Mutation 'R7122:Atp1a4'

552047

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7122 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172231936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 863 (Y863F)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111243
AA Change: Y863F

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: Y863F

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Meta Mutation Damage Score

0.3654

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	T	A	13: 4,511,276	E126V	probably benign	Het
Alg3	A	T	16: 20,607,852	L213H	probably damaging	Het
Atp6v0e	A	G	17: 26,695,416	T72A	probably benign	Het
Aup1	A	G	6: 83,055,142	T97A	probably benign	Het
Bcl6	T	C	16: 23,972,902	D234G	probably damaging	Het
Cdc42bpa	T	C	1: 180,065,018	L249P	probably damaging	Het
Celsr3	A	G	9: 108,828,567	K750E	possibly damaging	Het
Ces1g	C	A	8: 93,317,037	G425C	possibly damaging	Het
Chl1	T	C	6: 103,706,448	L745P	probably damaging	Het
Csmd2	G	A	4: 128,449,227	V1471M		Het
Dnah12	G	A	14: 26,778,912		probably null	Het
E330017A01Rik	C	A	16: 58,637,777	A54S	probably benign	Het
E4f1	G	A	17: 24,444,834	Q569*	probably null	Het
Fbxw24	A	T	9: 109,601,260	C439S	probably benign	Het
Gm11639	A	T	11: 105,008,961	I4350F	possibly damaging	Het
Gmip	C	T	8: 69,817,802	P721S	probably benign	Het
Grip1	A	G	10: 120,035,374	I669V	possibly damaging	Het
Gsn	A	T	2: 35,295,049	K339*	probably null	Het
Herc1	G	T	9: 66,399,774	A959S	possibly damaging	Het
Hic1	A	G	11: 75,169,230	V97A	probably benign	Het
Il11ra1	A	G	4: 41,766,189	Y242C	probably damaging	Het
Iqsec3	A	C	6: 121,473,358	V69G	unknown	Het
Jak3	T	A	8: 71,685,957	M933K	probably damaging	Het
Kbtbd7	G	A	14: 79,428,317	V530I	probably damaging	Het
Kif22	G	A	7: 127,032,978	R345C	probably benign	Het
Klhl7	G	A	5: 24,138,435	E250K	probably damaging	Het
Klk1b4	A	G	7: 44,211,107	H183R	probably damaging	Het
Lhfpl4	C	T	6: 113,176,671	V140I	probably benign	Het
Lhx5	T	A	5: 120,436,345	M238K	probably benign	Het
Lin28b	A	T	10: 45,469,148	H27Q	probably benign	Het
Mgat4c	A	T	10: 102,378,209	R18*	probably null	Het
Myct1	C	A	10: 5,604,492	H120N	probably damaging	Het
Nek1	A	T	8: 61,106,795	D984V	probably benign	Het
Nfu1	A	T	6: 87,009,881		probably benign	Het
Nipsnap1	A	T	11: 4,883,366		probably null	Het
Nlrp9c	A	G	7: 26,385,621	Y178H	probably damaging	Het
Nrxn3	T	A	12: 89,510,607	M520K	probably damaging	Het
Oacyl	A	G	18: 65,720,252	D143G	probably benign	Het
Obox5	A	G	7: 15,758,807	Y229C	probably damaging	Het
Olfr340	A	G	2: 36,452,690	Y35C	probably damaging	Het
Olfr347	G	A	2: 36,734,424	M34I	probably benign	Het
Olfr448	T	C	6: 42,897,090	V213A	probably damaging	Het
Olfr669	T	C	7: 104,939,198	L224P	probably damaging	Het
Otogl	C	T	10: 107,866,654	A713T	probably benign	Het
Pcdhb17	A	C	18: 37,486,513	N452T	probably benign	Het
Pi16	A	G	17: 29,326,339	Y192C	probably damaging	Het
Pla2g5	T	C	4: 138,804,519	D58G	probably damaging	Het
Plpp4	G	T	7: 129,379,483	V153F	unknown	Het
Plxna2	C	A	1: 194,644,568	S270*	probably null	Het
Pole	T	A	5: 110,325,102		probably null	Het
Prmt7	T	C	8: 106,235,100	F215S	unknown	Het
Ptpn21	C	T	12: 98,688,912	V599I	probably damaging	Het
Rab26	C	A	17: 24,530,678	R131L	probably damaging	Het
Raph1	A	T	1: 60,525,977	V117D	probably benign	Het
Sacs	T	C	14: 61,210,396	V3297A	probably damaging	Het
Serpine1	C	A	5: 137,066,942	A262S	probably benign	Het
Sgf29	A	G	7: 126,672,049	D193G	probably null	Het
Sh3rf2	G	A	18: 42,104,162		probably null	Het
Sipa1l1	T	C	12: 82,422,462	V1245A	possibly damaging	Het
Slc22a7	A	G	17: 46,438,298	L31P	probably damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Slc26a7	A	T	4: 14,533,639	Y395N	probably damaging	Het
Slc38a2	T	C	15: 96,693,301	M229V	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Susd1	G	A	4: 59,411,318	R225*	probably null	Het
Suz12	T	A	11: 79,993,593	F92I	probably damaging	Het
Tmem114	C	A	16: 8,424,746		probably benign	Het
Tmem68	A	G	4: 3,564,107	V159A	probably benign	Het
Tpra1	T	A	6: 88,908,294	I76N	probably damaging	Het
Trim45	A	G	3: 100,932,037	T752A	unknown	Het
Trp63	C	A	16: 25,820,477	H138Q	probably damaging	Het
Ugt2a2	T	C	5: 87,460,396	D528G	possibly damaging	Het
Vmn2r39	T	G	7: 9,014,762	K858N	possibly damaging	Het
Zfp629	A	T	7: 127,611,312	S442T	probably damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- ATATGGGAAGGGGCACTGTC -3'
(R):5'- AGCTCTAGAGTGTCTTCTGAACCC -3'

Sequencing Primer
(F):5'- AAGGGGCACTGTCACTTTATG -3'
(R):5'- AGTGTCTTCTGAACCCCGCATAC -3'

Posted On

2019-05-15